1. Introduction

La maladie de Whipple est une maladie due à une bactérie nommée Tropheryma whipplei. C'est une maladie rare (Incidence annuelle : un par million d'habitant) mais sa prévalence n'est pas réellement connue. Cette maladie a été décrite pour la première fois en 1907 par un médecin américain, George Whipple. Les manifestations cliniques sont variées et ne sont pas vraiment spécifiques entraînant parfois un retard diagnostique. L'évolution spontanée de la maladie est longue, marquées par des épisodes de rémission et de rechutes pouvant évolués jusqu'à la mort en l'absence de traitement.

T. whipplei a été considérée pendant longtemps comme non cultivable. Le premier isolement d'une souche de T. whipplei a été effectué dans notre laboratoire en 1999 à partir d'une valve cardiaque d'un patient atteint d'une endocardite de Whipple. Cette étape a été déterminante pour ouvrir de nouvelles perspectives pour la prise en charge diagnostique et thérapeutique de la maladie.

Références:

  1. Whipple's disease. Marth T, and D Raoult. Lancet 2003: 18, 239-246.
  2. Whipple's disease and Tropheryma whippelii”. Dutly F, and M Altwegg. Clin Microbiol Rev 2001: 14, 561-583.

2. Que sait-on du microorganisme?

La culture de cette bactérie sur fibroblastes humains a permis sa caractérisation. Les analyses phylogénétiques l'ont classés parmi les bactéries à Gram positif à haut GC%, proche de 2 espèces pathogènes chez l'homme, Actinomyces pyogenes et Rothia dentocariosa et d'autres bactéries de l'environnement.

La culture de cette bactérie a aussi permis le séquençage entier de son génome qui a été réalisé en parallèle sur deux souches distinctes. L'analyse du génome a montré la présence de gènes répétés facilitant les réarrangements génomiques de T. whipplei et pouvant permettre de modifier l'expression de protéines membranaires. Une éficience de synthèse de nombreux acides aminés a été aussi observée lors de l'analyse du génome. Afin de compenser ce déficit, nous avons développé un milieu de culture enrichi permettant la croissance de T. whipplei dans des conditions axéniques.

Références:

  1. Tropheryma whipplei Twist: a human pathogenic Actinobacteria with a reduced genome. Raoult et al. Genome Res 2003: 13:1800-9.
  2. Genome-based design of a cell-free culture medium for Tropheryma whipplei. Renesto et al. Lancet 2003: 362:447-9.

3. Habitat, source, et transmission de T. whipplei

La source de T. whipplei et sa transmission sont actuellement inconnues. La bactérie semble présente dans l'environnement. Des études basées sur la PCR ont montré la présence de l'ADN de T. whipplei dans des eaux d'égouts. Une hypothèse serait que la transmission s'effectue par voie orale. Plusieurs arguments sont en cette faveur : la présence de la bactérie dans les eaux de drainage, la possible transmission de la bactérie en association avec Giardia intestinalis ou par fibroscopie digestive.

La maladie de Whipple est ubiquitaire. Elle semble toutefois, plus fréquente dans certaines zones géographiques, en particulier, pour ce qui concerne la France, dans la région Rhône-Alpes, mais aussi la Suisse et l'Allemagne.

Références:

  1. Whipple's disease. Marth T, and D Raoult. Lancet 2003: 18, 239-46.
  2. Can Whipple's disease be transmitted by gastroscopes? La Scola et al. Infect Control Hosp Epidemiol 2003: 24, 191-4.
  3. Whipple's disease associated with giardiasis. Fenollar et al. J Infect Dis 2003: 188, 828-34.

4. Existe-t-il des groupes à risque?

Certaines études soulignent l'importance du terrain. Les hommes d'environ 50 ans sont les plus atteints. La maladie semble aussi plus fréquente chez les agriculteurs. Différentes anomalies immunologiques ont été rapportées lors de maladie de Whipple chez des patients traités mais les données sont restées pendant longtemps contradictoires. Récemment, une diminution de production de l'Interleukine-12 et d'IFN-gamma par les monocytes périphériques a été mise en évidence chez des patients atteints de maladie de Whipple par rapport aux sujets contrôles, non seulement en phase aiguë mais aussi en phase de rémission. Ces données restent à confirmer.

Références :

  1. Defects of monocyte interleukin-12 production and humoral immunity in Whipple's disease. Gastroenterology 1997 : 113 :442-448.
  2. Whipple's disease. Marth T, and D Raoult. Lancet 2003: 18, 239-246.

5. Les signes cliniques de la maladie de Whipple

Longtemps, la maladie de Whipple a été considérée comme une maladie purement digestive. En réalité, les manifestations cliniques sont très variées et non spécifiques. Environ 15% des patients ne présentent pas de signe digestif. La maladie débute, le plus souvent, par des arthralgies. Actuellement, nous pouvons distinguer 3 grands tableaux :

Références:

  1. Whipple's disease. Marth T, and D Raoult. Lancet 2003: 18, 239-246.
  2. Whipple's disease. Fenollar F, and D Raoult. Clin Diagn Lab Immunol 2001 : 8, 1-7.

6. Echantillons à prélever en cas de suspicion de maladie de Whipple

En cas de suspicion de maladie de Whipple, sang et LCR peuvent être facilement obtenus pour PCR et culture ainsi que salive et selles pour PCR. Des biopsies de l'intestin grêle doivent être réalisées même en absence de signes digestifs. En fonction de la symptomatologie, d'autres biopsies peuvent être effectuées pour coloration PAS, immunohistochimie et PCR. Enfin, si le diagnostic final de maladie de Whipple est réalisé, un LCR devra systématiquement être prélevé pour PCR car une atteinte neurologique asymptomatique est décrite.

Prélèvements à effectuer en fonction du tableau clinique:


Whipple digestif Endocardite Neuro-Whipple
Salive S S S
Selles S S S
Sang S S S
LCR A faire si diagnostic de Whipple certain A faire si diagnostic de Whipple certain S
Biopsie du grêle S S S
Valve cardiaque PN 2 2
Adénopathie, biopsie synoviale 2 2 2
Biopsie cérébrale PN PN Examen de 3ème intention

S Systématique, PN Pas nécessaire, 2 Examen de seconde intention.



Références:

  1. Whipple's disease. Marth T, and D Raoult. Lancet 2003: 18, 239-46.
  2. Molecular techniques in Whipple's disease. Expert Rev Mol Diagn 2001: 1, 299-309.

7. Eléments de diagnostic non spécifique de la maladie

L'hémogramme peut montrer une anémie. Une hyperéosinophilie peut être aussi observée de même qu'une élévation de la vitesse de sédimentation et de la Protéine C-réactive. Des signes de malabsorption digestive peuvent être présents.

L'analyse anatomopathologique avec la coloration à l'acide périodique de Schiff (=PAS) réalisée sur des biopsies diverses, classiquement sur des biopsies duodénales, ainsi que des liquides de ponction recherche la présence de macrophages contenant du matériel PAS positif.

Coloration au PAS positive d'une biopsie duodénale. Agrandissement x 100.

Références:

  1. Whipple's disease. Marth T, and D Raoult. Lancet 2003: 18, 239-246.
  2. Whipple's disease: immunospecific and quantitative immunohistochemical study of intestinal biopsy specimen. Lepidi et al. Human Pathol 2003: 34: 589-96..

8. Eléments de diagnostic spécifique de la maladie

Les éléments de diagnostic spécifique comporte :

L'immunohistochimie avec des anticorps polyclonaux de lapin dirigés spécifiquement contre la bactérie peut être réalisée sur différents prélèvements (duodénum, valve cardiaque, cerveau, adénopathie), ainsi que des liquides de ponction (liquide articulaire, humeur aqueuse) et du sang. Cet examen peut être réalisé rétrospectivement sur des prélèvements fixés.

Immunohistochimie positive d'une biopsie duodénale. Agrandissement x 100.

Références:

  1. Diagnosis of Whipple disease by immunohistochemical analysis: a sensitive and specific method for the detection of T. whipplei in paraffin-embedded tissue. Baisden et al. Am J Clin Pathol 2002: 118, 742-8.
  2. T. whipplei circulating in blood monocytes. Raoult et al. N Engl J Med 2001: 345, 548.
  3. Immunohistological detection of T. whipplei in lymph nodes. Lepidi et al. Am J Med 2002:118, 742-8.
  4. Immunodetection of T. whipplei in intestinal tissues from Dr Whipple's 1907 patient. Dumler et al. N Engl J Med 2003: 348:1411-2.

9. Amplification génique par PCR

La PCR peut être effectuée sur diverses biopsies, des liquides de ponction, du sang, des selles ou de la salive en utilisant des amorces ciblant différents gènes de la bactérie. L'obtention du génome de la bactérie a permis de rationaliser le choix des amorces. Une PCR en temps réel ciblant des séquences répétées de T. whipplei a permis d'augmenter la sensibilité de la technique sans altérer sa spécificité. L'ADN de T. whipplei a été retrouvé dans la salive, les biopsies duodénales, les liquides gastriques et les selles de sujets sains. Cependant, ces résultats doivent être interprétés avec prudence car ils sont basés sur des PCR « maisons » et n'ont jamais été confirmés par d'autres équipes. Le problème avec les PCR est le risque de contamination. Pour conclure à la positivité d'un prélèvement, il faut que 2 PCR ciblant 2 différentes séquences d'ADN soient positives.

10. Culture

La culture à partir de biopsies (duodénum, valve cardiaque...), de liquides de ponction ou du sang peut être réalisée grâce à des techniques de culture cellulaire ou de culture axénique supplémentée en acide aminé.

Références:

  1. Use of genome selected repeated sequences increases the sensitivity of PCR detection of T. whipplei. Fenollar et al. J Clin Microbiol 2004: 42, 401-3.
  2. Culture of T. whipplei from human samples: a 3-year experience (1999 to 2002). J Clin Microbiol 2003: 41, 3816-22.

11. Amorces ciblant spécifiquement Tropheryma whipplei publiés dans la littérature.


Gène cible Sequences Sens/Antisens Amorces Sens/Antisens
ITS tws3,f 5'CCGGTGACTTAACCTTTTTGGAGA3'
tw1857r1 5'TCCCGAGCCTTTCCGAG A3'
ITS tw1662f 5'ACTATTGGGTTTTGAGAGGC3'
tw1857r1 5'TCCCGAGCCTTATCCGAG A3'
ITS tws1,f 5'ATCGCAAGGTGGAGCGAATCT3'
tws2,r 5'CGCATTCTGGCGCCCCAC3'
ITS tws3,f 5'CCGGTGACTTAACCTTTTTGGAGA3'
tw1857r1 5'TCCCGAGCCTTATCCGAGA3'
ITS tws3,f 5'CCGGTGACTTAACCTTTTTGGGA3'
tws4,r 5'CTCCCGTGAGCTTGTGCCCAAAC3'
23S rDNA TW-23InsF 5'GGTTGATATTCCCGTACCGGCAAAG3'
TW-23InsR2 5'GCATAGGATCACCAATTTCGCGCC3'
hsp65 whipp-frw1 5'TGACGGGACCACAACATCTG3'
whipp-rev 5'ACATCTTCAGCAATGATAAGAAGTT3'
hsp65 whipp-frw2 5'CGCGAAAGAGGTTGAGACTG3'
whipp-rev 5'ACATCTTCAGCAATGATAAGAAGTT3'
rpoB TwrpoB.F 5'AAAAAGGCCGCACGCGAGTT'
TwrpoB.R 5'AAAGAGGCTCCAACGCCACG3'
Repeat 53.3F 5'AGAGAGATGGGGTGCAGGAC3'
53.3R 5'AGCCTTTGCCAGACAGACAC3'

Références:

  1. Molecular genetic methods for the diagnosis of fastidious microorganisms. Fenollar F, and D Raoult. APMIS 2004; 112:785-807.

12. Comment interpréter les résultats ?

Quand un patient présente une maladie « typique » avec des signes digestifs, des adénopathies et/ou des arthralgies, le diagnostic est facile.

En cas de maladie sans atteinte digestive (endocardite, atteinte neurologique...), le diagnostic est plus difficile. Un des problèmes est d'interpréter une PCR + isolée sur sang ou LCR. Ces résultats doivent toujours être confirmés. Dans ces cas, la présence d'une PCR + sur salive ou selles peut être utile pour confirmer le diagnostic.

Stratégie d'interprétation des résultats en fonction des échantillons et des techniques :

* Nécessité de confirmer sur un second échantillon éventuellement en ciblant une nouvelle cible ADN ; NE: Non effectué, -: négatif; +: positif

Références:

  1. Molecular genetic methods for the diagnosis of fastidious microorganisms. Fenollar F, and D Raoult. APMIS 2004; 112:785-807.

13. Quel est le traitement de la maladie de Whipple?

Whipple sans atteinte neurologique (PCR dans le LCR négative)

Doxycycline (Vibramycine®) cp 100mg, 1 cp 2 fois/j. En association avec Hydroxychloroquine (Plaquenil®) cp 200mg, 1 cp 3 fois/j.

Cette association est administrée pendant une période de 18 mois.

Whipple avec une atteinte neurologique

Doxycycline (Vibramycine®) cp 100mg, 1 cp 2 fois/j. En association avec Hydroxychloroquine (Plaquenil®) cp 200mg, 1 cp 3 fois/j. En association avec Sulfaméthoxazole: 800 mg et Triméthoprime: 160 mg = Bactrim Forte® : 2 cp 3 fois/j Cette association est administrée pendant une période minimale de 18 mois. De plus : Ajout de l'acide folique (Spéciafoldine®): 1 cp à 10 mg/j chez les patients > à 65 ans et les patients carencés

Références:

  1. Antibiotic susceptibility of Tropheryma whipplei in MRC5 cells. Boulos et al. Antimicrob Agents Chemoter 2004: 48, 747-752.
  2. Molecular evaluation of antibiotic susceptibility against Tropheryma whipplei in axenic medium. Boulos et al. J Antimicrob Chem 2005: 2, 178-181.

14. Existe-il des contre-indications aux traitements ?

Doxycycline (Vibramycine®)

Hydroxychloroquine (Plaquénil®)

Cotrimoxazole (Bactrim Forte®)

15. Existe-il des effets indésirables des traitements?

Doxycycline (Vibramycine®)

Photosensibilisation (il faut insister sur la nécessité, sous peine de brûlures, de protéger la face et les mains du soleil, en particulier l'été). Troubles digestifs, réactions allergiques, troubles hématologiques, pigmentation cutanée.

Hydroxychloroquine (Plaquénil®)

Photosensibilisation, acouphènes, vertiges, troubles digestifs, réactions cutanéo-muqueuses, céphalées, dépôts cornéens régressifs à l'arrêt du traitement, troubles hématologiques, rétinopathie, psychose.

Cotrimoxazole (Bactrim Forte®)

Allergies cutanées, troubles hématologiques, troubles digestifs, hépatite, colite pseudomembraneuse, altération de la fonction rénale, lithiase urinaire, méningite aseptique.

16. Quel est l'évolution et le pronostic de la maladie?

En l'absence de traitement antibiotique adapté, l'évolution de la maladie de Whipple est mortelle.

Chez les patients traités de manière adéquate, la diarrhée disparaît rapidement, en moins d'une semaine. Les arthralgies par contre régresse un peu plus lentement, en 2 à 3 semaines. Quant aux signes neurologiques, leur régression s'observe généralement, plus de 3 semaines, après le début d'une antibiothérapie adaptée. De plus, des séquelles neurologiques sont fréquemment observées.

Après l'arrêt du traitement, des rechutes sont à redouter, en particulier, au niveau cérébral. Leur fréquence a été diversement estimée entre 2 et 35%.

Après l'arrêt de l'antibiothérapie, il est conseillé de suivre le patient à vie.

Références:

  1. Whipple's disease. Marth T, and D Raoult. Lancet 2003: 18, 239-246.

17. Quel est le suivi des patients atteints de maladie de Whipple en cours de traitement?

Mensuelle :

NFS, SGOT, SGPT, GGT, créatininémie.

Immunohistochimie des monocytes sanguins ainsi que prélèvements salivaire, sanguin et des selles pour PCR. Taux plasmatiques des médicaments administrés afin de vérifier la présence d'un taux thérapeutique:

A réaliser en plus deux mois après le début du traitement :

LCR pour PCR et dosages des antibiotiques (doxycycline et sulfaméthoxazole)

Semestrielle :

Consultations d'ophtalmologie : Examen à la lampe à fente et électrorétinogramme.

18. Quel est le suivi des patients atteints de maladie de Whipple après arrêt du traitement?

Tous les mois pendant 3 mois

Tous les 3 mois pendant 5 ans

Une fois par an à vie :

19. Quel est l'état de la recherche sur le sujet?

La recherche porte actuellement sur :

20. Correspondants au sein de l'IFR 48

Consultation au sein de l'IFR 48

Consultation du Pr D. Raoult

Mercredi matin
Fédération de Microbiologie Clinique
Hôpital de la Timone
264, Rue Saint-Pierre
13385 Marseille
Tél. 04.91.38.55.14 ou 19

20.1. Quels prélèvements envoyer et comment ?

D'autre part, il est possible d'adresser d'anciens prélèvements fixés du patient pour analyse par immunohistochimie.

Adresser les prélèvements à :

Unité des Rickettsies
Faculté de Médecine
27, Boulevard Jean Moulin
13385 Marseille
France

20.2. Fiche de recueil de renseignements cliniques

Telechargeable au format PDF ici

20.3. Fiche d'information pour les patients

La maladie de Whipple est déterminée par une bactérie qui s'appelle Tropheryma whipplei. La bactérie vit dans le milieu extérieur, peut être l'eau, sans que l'on connaisse la source de l'infection. La maladie est, toutefois, plus fréquente dans certaines zones géographiques, en particulier, pour ce qui concerne la France, dans la région Rhône-Alpes, mais aussi la Suisse et l'Allemagne.

La maladie se présente sous différentes manières. La forme la plus habituelle est celle d'une atteinte digestive avec une diarrhée importante, associée à un amaigrissement et une peau qui devient plus foncée. Cette forme est souvent associée à la présence de ganglions, à des douleurs articulaires qui peuvent être le premier signe de la maladie. Parfois, cette maladie est confondue avec une arthrite ou une polyarthrite rhumatoïde au départ. Quoiqu'il en soit, dans la forme habituelle, il existe une localisation au niveau du tube digestif de la bactérie. Ceci justifie au départ et dans le suivi de la maladie, que l'on fasse une fibroscopie avec une biopsie pour analyser la présence de la bactérie, aussi bien au niveau du diagnostic, que dans le suivi thérapeutique. Par ailleurs, la bactérie peut se fixer à différents endroits, au niveau du cerveau, donnant une méningite avec une atteinte cérébrale plus ou moins importante, et au niveau du coeur en donnant une atteinte des valves cardiaques qui entraîne un dysfonctionnement du coeur.

Sans traitement, l'évolution de la maladie de Whipple est toujours mortelle. Son traitement est long (toujours supérieur à 1 an) et après l'arrêt du traitement, parfois y compris après des traitements très longs, des rechutes sont à redouter, en particulier, au niveau cérébral.

Un suivi patient et régulier de la maladie de Whipple doit permettre dans tous les cas, au moins d'arrêter la maladie et souvent de la guérir complètement.

La bactérie a été cultivée pour la première fois dans notre laboratoire à Marseille, en 1999, et ceci a permis la mise au point d'un certain nombre d'outils pour faire le diagnostic.

Le diagnostic peut être fait par la détection de la bactérie ou de ses gènes, par des techniques moléculaires. On recherche la présence de la bactérie dans le sang, dans la salive et dans les selles, chez tous les malades. Chez les malades qui ont une localisation digestive, on la recherche, par ailleurs, dans la biopsie digestive, qui doit être faite une fois par an.

Chez les malades qui ont une localisation cérébrale, on la recherche dans le liquide céphalo-rachidien obtenu par la ponction lombaire. Celle-ci est faite d'abord pour le diagnostic, puis tous les 2 mois, afin de vérifier que la bactérie a disparu. Après la fin du traitement, une ponction lombaire sera proposée de manière annuelle, de façon à détecter une éventuelle rechute. Un certain nombre d'examens radiologiques cérébraux peuvent être justifiés aussi dans ce cadre.

Sur le plan du traitement, la connaissance a progressé rapidement ces dernières années, grâce à la culture de la bactérie. Pour les formes habituelles, il semble que le traitement le plus efficace soit l'association de Vibramycine et de Plaquénil. Le Plaquénil permet de rendre dans les cellules la Doxycycline efficace. Ce traitement est bien supporté mais comprend un risque de coup de soleil très sévère, si on s'expose au soleil. Il faut prendre des précautions drastiques, pour éviter de s'exposer au soleil (port de vêtement, de chapeau, de gants, écran total). Par ailleurs, tous les 6 mois, il faut faire un examen ophtalmologique spécialisé, afin de détecter l'accumulation du Plaquénil dans l'oeil. Les concentrations de ces antibiotiques sont dosées lorsque vous venez à la consultation et l'objectif est d'atteindre une concentration de 1 mcg par ml de Plaquénil et de plus de 5 mcg par ml pour la Doxycycline.

Pour les formes neurologiques, le traitement de référence est constitué par le Bactrim. Malheureusement, il existe dans 20% des cas des rechutes et nous pensons que la cause de ces rechutes est liée à la concentration du Bactrim qui est trop faible. Ceci a été confirmé par l'analyse de la bactérie au laboratoire, qui a montré qu'elle était peu sensible au Bactrim. Dans ces conditions, nous utilisons maintenant une concentration de Bactrim beaucoup plus élevée (6cps de Bactrim forte par jour) qui permet d'obtenir des taux 20 à 30 fois plus importants que ceux nécessaire pour tuer la bactérie. Ceci justifie le dosage chez ces patients du Bactrim, dans le liquide céphalo-rachidien obtenu par ponction lombaire, qui permet de préjuger d'une bonne efficacité. Le traitement n'est jamais inférieur à 1 an et ensuite, le suivi pour éviter une rechute, se poursuit toute la vie.

Le résultat des prélèvements que vous avez eu, pour le diagnostic ou le suivi thérapeutique, de même que les documents (radiologique, biopsique) sont susceptibles d'être utilisés (de façon anonyme) pour la recherche sur votre maladie et dans le cadre d'une publication.

Contact

Professeur Didier RAOULT
HOPITAL DE LA TIMONE
Tél. 04.91.38.55.14/19
Mail : didier.raoult@medecine.univ-mrs.fr