1. Introduction

La fièvre Q est une zoonose (maladie transmissible d'un animal vertébré à l'homme) ubiquitaire causée par une bactérie intracellulaire appelée Coxiella burnetii. La fièvre Q a été décrite pour la première fois en 1935 chez des employés d'un abattoir de Brisbane en Australie. L'infection a dans un premier temps été appelée fièvre des abattoirs puis « Query fever », query signifiant « question » pour souligner les incertitudes concernant son étiologie et son épidémiologie. La maladie est caractérisée par la grande variabilité de sa présentation clinique : La fièvre Q aiguë est la primo-infection, généralement bénigne sauf chez certains sujets à risque de développer une forme chronique : femmes enceintes, porteurs d'anomalies des valves cardiaques, immunodéprimés. La fièvre Q chronique, dont la forme la plus fréquente est une endocardite, fait la gravité de l'affection, avec une mortalité de 25 à 60% en l'absence de traitement.

Références

  1. Raoult D. Q fever : still a mysterious disease. QJM 2002;95:491-492 Marrie TJ, Raoult D. Update on Q fever, including Q fever endocarditis. Curr Clin Top Infect Dis 2002;22:97-124.

2. Que sait-on du microorganisme : Coxiella burnetii

Coxiella burnetii est une bactérie à gram négatif de petite taille, intracellulaire stricte. La coloration de gram n'est pas utilisable. C'est la coloration de Gimenez qui permet de mettre en évidence la bactérie. Les études phylogénétiques plus récentes, principalement basées sur l'étude de la séquence du gène codant l'ARN ribosomal 16S, ont montré que le genre Coxiella appartient à la subdivision gamma des Proteobacteria, proche des genres Legionella, Francisella et Rickettsiella. Le cycle intracellulaire est complexe et aboutit à la formation de pseudo-spores, métaboliquement inactives, résistantes à la pression osmotique, et qui jouerait un rôle dans les capacités de résistance de la bactérie dans le milieu extérieur : Coxiella burnetii peut survivre 40 mois dans du lait conservé à température ambiante, deux ans à - 20°C, 49 jours dans des urines et 7 à 9 mois dans de la laine conservée à 20°C. Ces souches supportent des grandes variations de pH, sont thermostables (survivent 30 minutes à 60°C) et résistent à la dessiccation, et à de nombreux antiseptiques et désinfectants aux concentrations habituelles. La facilité d'obtention de la bactérie (à partir de placentas de ruminants), sa résistance dans le milieu extérieur (et en particulier à la dessication grâce à la formation de pseudo- spores), son pouvoir pathogène et sa transmission par aérosols, font de Coxiella burnetii un excellent candidat au bioterrorisme.

3. Génétique

Le génome de Coxiella burnetii a été séquencé et mesure 1.995.275 paires de base mais semble varier d'une souche à l'autre. Il semblerait également que le génome de Coxiella burnetii serait dans une phase précoce de réduction durant laquelle les gènes dégradés ou non fonctionnels sont éliminés alors que le microorganisme devient plus dépendant de son hôte en matière de nutrition.

Quatre types de plasmides ont été identifiés qui permettent de définir 4 génotypes qui seraient associés à des types lipopolysaccharidiques différents, des cinétiques de croissance différentes, voire à des variations de leur pouvoir pathogène.

Référence

  1. Seshadri R, Paulsen IT, Eisen JA, Read TD, Nelson KE, Nelson WC, Ward NL, Tettelin H, Davidsen TM, Beanan MJ, Deboy RT, Daugherty SC, Brinkac LM, Madupu R, Dodson RJ, Khouri HM, Lee KH, Carty HA, Scanlan D, Heinzen RA, Thompson HA, Samuel JE, Fraser CM, Heidelberg JF. Complete genome sequence of the Q-fever pathogen Coxiella burnetii. Proc Natl Acad Sci U S A. 2003 Apr 29;100(9):5455-60. Epub 2003 Apr 18.

4. Variations antigéniques

Coxiella burnetii présente une variation antigénique, liée à des modifications du lipopolysaccharide de surface (LPS).

Lors d'une fièvre Q aiguë, sont produits des les anticorps dirigés contre l'antigène de phase II, alors que des taux élevés d'anticorps dirigés contre l'antigène de phase I sont détectés au cours des fièvres Q chroniques.

Référence

  1. Raoult D, Marrie TJ, Mege JL. Natural history and pathophysiology of Q fever. Lancet Infect Dis 2005;5:219-26

5. Habitat - Réservoir

La bactérie vit en infectant la plupart des mammifères domestiques (bovins, ovins, buffles, caprins, chevaux, chameaux, chiens, chats, lapins) et sauvages (cervidés, ours, renards, marsupiaux, rongeurs) mais également les oiseaux domestiques (poules, dindes, oies, canard...) ou sauvages (pigeons)

Coxiella burnetii est également retrouvée dans de nombreuses espèces de tiques, les poux ainsi que les amibes. Les animaux éliminent le microorganisme en grand nombre dans les urines, les selles, le lait et plus spécialement dans les produits de mise bas (placenta, liquide placentaire) et d'avortements. Par ailleurs, la bactérie est présente dans le lait après l'accouchement.

6. Modes de transmission

Il suffit d'une bactérie pour infecter un être humain. L'homme contracte la maladie le plus souvent par inhalation d'aérosols infecté par Coxiella burnetii. Le plus souvent le bétail est en cause mais parfois aussi les chiens, les chats et les pigeons. Dans certaines conditions, la bactérie peut être disséminée par le vent, si bien que la maladie peut survenir chez des sujets qui n'ont aucun contact direct évident avec les animaux comme cela a été montré dans la région de Martigues dans le sud de la France. Plusieurs épidémies de fièvre Q ont été décrites dans des vallées des Alpes suite à des passages de troupeaux en transhumance.

L'ingestion de produits laitiers non pasteurisés est probablement un mode de transmission mineur. La transmission directe interhumaine reste anecdotique, le plus souvent lors de manoeuvres obstétricales chez des femmes infectées.

Bien que Coxiella burnetii puisse être mise en évidence chez de nombreux arthropodes, en particulier des tiques, ce mode de transmission n'est probablement pas significatif, sauf en cas de transmission concommitante d'un autre agent pathogène transmis par les arthropodes tel que Rickettsia conorii, Rickettsia slovaca, Rickettsia africae, ou Francisella tularensis.

Références

  1. Tissot-Dupont H, Torres S, Nezri M, Raoult D. Hyperendemic focus of Q fever related to sheep and wind. Am J Epidemiol. 1999 Jul 1;150(1):67-74.
  2. Tissot-Dupont H, Amadei MA, Nezri M, Raoult D. Wind in November, Q fever in December. Emerg Infect Dis 2004 ;10 :1624-1629.
  3. Rolain JM, Gouriet F, Brouqui P, Larrey D, Janbon F, Vene S, Jarnestrom V, Raoult D. Concomitant or consecutive infection with Coxiella burnetii and tickborne diseases. Clin Infect Dis. 2005 Jan 1;40(1):82-8. Epub 2004 Dec 8.

7. Fréquence de la maladie

La fréquence de la maladie n'est pas connue avec précision, et varie énormément d'une région à l'autre, en raison des variations d'exposition aux ruminants. De plus, la fièvre Q est souvent bénigne ou asymptomatique et ne peut être diagnostiquée que par des examens biologiques réalisés dans des laboratoires spécialisés.

Malgré tout, des données régionales, comme celles du Centre National de Référence permettent d'estimer l'incidence de la fièvre Q aiguë à 50 pour 100 000 habitants par an dans le sud de la France. L'incidence de l'endocardite est estimée à 1 pour un million d'habitants par an. La fièvre Q représente 5% de l'ensemble des cas d'endocardite en France.

Références

  1. Raoult D, Tissot-Dupont H, Foucault C, Gouvernet J, Fournier PE, Bernit E, Stein A, Nesri M, Harle JR, Weiller PJ. Q fever 1985-1998. Clinical and epidemiologic features of 1,383 infections. Medicine (Baltimore). 2000 Mar;79(2):109-23.

8. Distribution de la maladie : age et sexe

Le sexe ratio et l'âge des sujets infectés par Coxiella burnetii varie d'une zone à l'autre. Dans les zones où le principal facteur de risque est l'exposition au bétail, la maladie est plus fréquente dans la population active de 30 à 60 ans, plus volontiers chez l'homme. Lorsque le facteur de risque principal est l'exposition aux animaux de compagnie, le sexe ratio s'équilibre.

Le risque d'être infecté par Coxiella burnetii n'est pas lié au sexe, mais l'expression clinique est plus fréquente chez l'homme.

Les cas pédiatriques ne représentent que 1 à 2% des cas diagnostiqués, alors que l'exposition et l'infection des enfants est au moins la même que celle des adultes. Par ailleurs, lorsque les enfants sont symptomatiques, le sexe ratio est de 1, puis bascule en faveur des hommes à partir de 15 ans. Cette modification du sexe ratio avec l'âge suggère un facteur protecteur de l'expression clinique propre au sexe féminin, dont la nature hormonale (17 beta oestradiol) a été récemment démontrée.

Références

  1. Leone M, Honstettre A, Lepidi H, Capo C, Bayard F, Raoult D, Mege JL. Effect of sex on Coxiella burnetii infection: protective role of 17beta-estradiol. J Infect Dis 2004;189:339-45
  2. Maltezou HC, Constantopoulou I, Kallergi C, Vlahou V, Georgakopoulos D, Kafetzis, DA, Raoult D. Q fever in children in Greece. Am J Trop Med Hyg 2004;70:540-4. Maltezou HC, Raoult D. Q fever in children. Lancet Infect Dis 2002;2:686-91.

9. Distribution saisonnière

En Europe, l'incidence maximale se situe au printemps et au début de l'été.

Dans le sud de la France, où la transmission se fait préférentiellement par des aérosols infectés transportés par le vent, la transmission est maximale lorsque le mistral souffle le plus violemment, en période mise bas secondaire. En revanche, lors de la principale période de mise bas à l'automne, l'absence de vent diminue la transmission.

Références

  1. Tissot-Dupont H, Torres S, Nezri M, Raoult D. Hyperendemic focus of Q fever related to sheep and wind. Am J Epidemiol. 1999 Jul 1;150(1):67-74.

10. Distribution géographique

La fièvre Q a été retrouvée pratiquement dans le monde entier, à l'exception de la Nouvelle Zélande. Dans la plupart des pays, la fièvre Q humaine ne fait pas partie des maladies à déclaration obligatoire, hormis aux Etats-Unis.

Par conséquent, la connaissance de l'épidémiologie ne peut être qu'extrapolée à partir d'enquêtes sur des épidémies, d'enquêtes de séroprévalence chez l'homme et chez l'animal, ou de données issues des laboratoires de Santé Publique et des Centres de Référence.

11. Groupes à risque

La fièvre Q est classiquement une maladie liée aux activités professionnelles. Les sujets à risque « classiques » sont donc ceux en contact avec des animaux, et en particulier les éleveurs, les ouvriers d'abattoirs et les vétérinaires. Le personnel des laboratoires est également à risque, principalement lors de la manipulation d'échantillons animaux ou humains contenant Coxiella burnetii en phase I. Les personnes en contact avec des animux de compagnie (chats, chiens, etc...) sont exposées, principalement lors des mises bas.

En ce qui concerne la fièvre Q chonique, les sujets à risque sont les porteurs d'une valvulopathie ou d'une prothèse valvulaire, les sujets immunodéprimés et les femmes enceintes.

Sur un plan règlementaire, les « affections dues aux rickettsies, et en particulier la fièvre Q » sont reconnues comme maladies professionnelles dans les deux régimes :tableau 53 du Régime général et tableau 49 du Régime agricole. Sont prises en charge les manifestations aiguës, avec un délai de 21 jours et les manifestations chroniques : endocardite et hépatite granulomateuse, avec un délai de 10 ans. Le diagnostic doit être confirmé par un examen de laboratoire spécifique. Les travaux considérés comme susceptibles de provoquer la maladie sont ceux exposant au contact avec les bovins, caprins, ovins, leurs viscères ou leurs déjections, ainsi que les travaux exécutés dans les laboratoires effectuant le diagnostic de fièvre Q ou des recherches biologiques vétérinaires.

12. Signes cliniques

Dans l'état actuel des connaissances, l'histoire naturelle de la maladie commence par un contact entre un individu non immun et Coxiella burnetii.

C'est le mode de contamination qui détermine la période d'incubation, la sévérité de la maladie ainsi que les manifestations cliniques. La période d'incubation de la fièvre Q aiguë est d'environ 20 jours (2 à 3 semaines).

La primo-infection qui survient alors peut être asymptomatique (dans 60 % des cas) ou symptomatique, sous la forme d'une fièvre Q aiguë. Seuls 4 % des patients symptomatiques présentent un tableau clinique suffisament grave pour nécessiter une hospitalisation. Chez le sujet sain, l'évolution spontanée est une guérison complète.

Chez certains sujets, Coxiella burnetii est capable de se multiplier malgré la réponse déclenchée par la primo-infection, que celle-ci soit symptomatique ou non. Ces sujets à risque sont les femmes enceintes, les porteurs d'une anomalie des valves cardiaques ou des vaisseaux sanguins, les immunodéprimés (infection VIH, splénectomie, diabète, cancer, traitements immunosuppresseurs ...). Lorsque le système immunitaire est incapable de contrôler l'infection, une fièvre Q chronique peut se développer.

Références

  1. Raoult D, Marrie T, Mege J. Natural history and pathophysiology of Q fever. Lancet Infect Dis. 2005 Apr;5(4):219-26.
  2. Marrie TJ, Raoult D. Update on Q fever, including Q fever endocarditis. Curr Clin Top Infect Dis. 2002;22:97-124. Review.
  3. Raoult D, Tissot-Dupont H, Foucault C, Gouvernet J, Fournier PE, Bernit E, Stein A, Nesri M, Harle JR, Weiller PJ. Q fever 1985-1998. Clinical and epidemiologic features of 1,383 infections. Medicine (Baltimore). 2000 Mar;79(2):109-23.

13. Fièvre Q aiguë

Le début est généralement brutal, dans un tableau associant fièvre élevée (91%), céphalées (51%), myalgies (37%), arthralgies (27%) et toux (34%).

La présentation clinique varie selon le pays, voire la région à l'intérieur d'un pays :

Il existe également d'autres formes cliniques, plus rares :

Références

  1. Raoult D, Tissot-Dupont H, Foucault C, Gouvernet J, Fournier PE, Bernit E, Stein A, Nesri M, Harle JR, Weiller PJ. Q fever 1985-1998. Clinical and epidemiologic features of 1,383 infections. Medicine (Baltimore). 2000 Mar;79(2):109-23.

14. Risque évolutif

Toute fièvre Q aiguë, qu'elle soit symptomatique ou non, risque d'évoluer vers une forme chronique, chez les sujets prédisposés : femmes enceintes, valvulopathes, splénectomisés, immunodéprimés (et en particulier les sujets atteints de lymphome). En ce qui concerne les valvulopathes, 38% de ceux d'entre eux qui présentent une fièvre Q aiguë développeront une endocardite dans les 2 ans.

Par conséquent, lorsqu'un diagnostic de fièvre Q aiguë est posé, que le patient soit symptomatique ou non, la recherche de circonstances pouvant favoriser la chronicisation doit être systématique :

Références

  1. Raoult D, Marrie T, Mege J. Natural history and pathophysiology of Q fever. Lancet Infect Dis. 2005 Apr;5(4):219-26.
  2. Fenollar F, Fournier PE, Carrieri MP, Habib G, Messana T, Raoult D. Risks factors and prevention of Q fever endocarditis. Clin Infect Dis. 2001 Aug 1;33(3):312-6. Epub 2001 Jun 25.

15. Fièvre Q chronique : endocardite

Le tableau clinique le plus fréquent et le mieux connu de fièvre Q chronique est l'endocardite, qui fait toute la gravité de l'infection, avec une léthalité de 25 à 60% en l'absence de traitement. Le diagnostic d'endocardite risque d'être réfuté devant des patients volontiers apyrétiques ou présentant une fièvre peu élevée et intermittente. De plus, l'échographie cardiaque est souvent peu contributive, montrant rarement les végétations. La fièvre Q doit donc être systématiquement évoquée, et une sérologie prescrite, devant un patient porteur d'une lésion valvulaire et présentant des signes cliniques évocateurs (fièvre, hépatite, asthénie, hippocratisme digital, amaigrissement, insuffisance rénale), ou des signes biologiques (accélération de la vitesse de sédimentation, élévation des transaminases, thrombocytopénie). Le diagnostic pourra être porté en utilisant les critères de Duke modifiés. Grâce à une meilleure connaissance de la maladie, les délais de diagnostic sont devenus plus courts et un traitement antibiotique adapté peut être proposé aux patients. Dans ces conditions, la présentation clinique évolue, avec une diminution des défaillances cardiaques, des hépatomégalies, des syndromes inflammatoires, des anémies, des leucopénies et des perturbations des bilans hépatiques. Une hypersécrétion d'IL-10 est retrouvée chez les patients atteints d'une endocardite de la fièvre Q. L'IL-10 peut être considérée chez ces patients comme un marqueur de rechûte et peut servir au suivi de l'efficacité du traitement.

Références

  1. Marrie TJ, Raoult D. Update on Q fever, including Q fever endocarditis. Curr Clin Top Infect Dis. 2002;22:97-124. Review.
  2. Fournier PE, Casalta JP, Habib G, Messana T, Raoult D. Modification of the diagnostic criteria proposed by the Duke Endocarditis Service to permit improved diagnosis of Q fever endocarditis. Am J Med. 1996 Jun;100(6):629-33.
  3. Houpikian P, Habib G, Mesana T, Raoult D. Changing clinical presentation of Q fever endocarditis. Clin Infect Dis. 2002 Mar 1;34(5):E28-31. Epub 2002 Jan 23.
  4. Capo C, Zaffran Y, Zugun F, Houpikian P, Raoult D, Mege JL. Production of interleukin-10 and transforming growth factor beta by peripheral blood mononuclear cells in Q fever endocarditis. Infect Immun. 1996 Oct;64(10):4143-7.

16. Fièvre Q chronique : autres tableaux cliniques

L'infection vasculaire est le deuxième tableau clinique de fièvre Q chronique. Un anévrisme de l'aorte peut ainsi s'infecter et se compliquer d'une fistule intestinale ou d'une spondylite. De même, une prothèse vasculaire peut être infectée par Coxiella burnetii. Le pronostic est réservé en l'absence de traitement chirurgical et médical.

D'autres manifestations plus rares de la fièvre Q chronique ont été décrites : ostéomyélites, hépatites chroniques chez des alcooliques, pseudo-tumeurs spléniques ou pulmonaires, infection de drain ventriculo-péritonéal.

Référence

  1. Marrie TJ, Raoult D. Update on Q fever, including Q fever endocarditis. Curr Clin Top Infect Dis. 2002;22:97-124. Review.

17. Fièvre Q et grossesse : risques spécifiques

Lorsqu'une femme enceinte est infectée par Coxiella burnetii au cours de la grossesse, la bactérie va se fixer au niveau de l'utérus et des glandes mammaires. Les conséquences sont majeures :

  1. Risque immédiat pour la mère, qui présente volontiers une forme plus grave de fièvre Q aiguë
  2. Risque immédiat pour l'enfant : 100% d'avortements lorsque l'infection survient au 1er trimestre de la grossesse, et risque de prématurité et de petit poids de naissance si l'infection est contractée au 2ème ou 3ème trimestre.
  3. Risque à distance de chronicité, lié à la durée de l'infection pendant la grossesse (> 3 mois). A noter que le traitement de l'épisode aigu n'empêche pas l'évolution vers la chronicité.

18. Fièvre Q et grossesse : manifestations et prise en charge

Les manifestations cliniques seront celles d'une fièvre Q aiguë, allant de la fièvre isolée chez une femme enceinte à des signes de fièvre Q aiguë associés à un avortement avec retard de croissance. La survenue d'un avortement et/ou d'un retard de croissance intra utérin en dehors de tout contexte inefctieux doit également faire évoquer la fièvre Q.

Après l'accouchement :

Références

  1. Raoult D, Fenollar F, Stein A. Q fever during pregnancy: diagnosis, treatment, and follow-up. Arch Intern Med. 2002 Mar 25;162(6):701-4.
  2. Stein A, Raoult D. Q fever during pregnancy: a public health problem in southern France. Clin Infect Dis. 1998 Sep;27(3):592-6. Review.

19. Diagnostic biologique

Approche générale Le diagnostic de cette maladie est souvent délicat car ces bactéries sont difficiles à cultiver. L'approche diagnostique nécessite donc le plus souvent l'utilisation de plusieurs méthodes complémentaires en fonction du statut immunitaire du patient et de la symptomatologie.

Le diagnostic non spécifique de la maladie doit comprendre une numération formule sanguine, un ionogramme avec bilan hépatique et un TCA, et en fonction du contexte une analyse de LCR, la recherche d'autoanticorps et un examen anatomopathologique standard de biopsies.

Le diagnostic spécifique repose sur :

20. Sérologie

La réaction d'immunofluorescence indirecte est actuellement la technique de référence pour le sérodiagnostic de la fièvre Q employée au centre national. Il s'agit d'une méthode simple et extrêmement fiable.

Tous les sérums reçus au centre sont testés en dépistage, l'antigène utilisé est la souche de référence Nine Mile cultivée sur fibroblastes de souris L929. Les sérums positifs en dépistage sont ensuite étudiés pour les deux phases antigéniques (Phase I et Phase II) et les IgG, IgM et IgA sont quantifiés pour ces deux phases. La réalisation de ces quantifications permet sur un sérum unique le diagnostic de forme aiguë ou chronique dans la majorité des cas. A noter qu'il est toujours demandé un second sérum à 15 jours d'intervalle du premier afin d'objectiver une ascension des titres, ou une séroconversion. La séroconversion s'observe en général entre 7 jours et 30 jours après le début des symptômes cliniques, et environ 90% des patients ont des taux d'anticorps détectables 3 semaines après le début des symptômes. Les autres techniques sérologiques et en particulier la fixation du complément manquent de sensibilité et de spécificité. L'interprétation des taux sérologiques dépend de la technique utilisée et donc du laboratoire qui la pratique, ainsi que de la prévalence de la maladie dans la région.

Référence

  1. Tissot-Dupont H, Thirion X, Raoult D. Q fever serology: cutoff determination for microimmunofluorescence. Clin Diagn Lab Immunol. 1994 Mar;1(2):189-96.

21. Biologie moléculaire

L'amplification directe par PCR à partir de différents prélèvements biopsiques (valve cardiaque, placenta, anévrysme, LCR, ...), du sang ou du sérum est la technique la plus spécifique pour effectuer le diagnostic d'infection à Coxiella burnetii en particulier pour le diagnostic des endocardites à partir de la valve cardiaque. Ce sont des techniques invasives, nécessitant la pratique de biopsies tissulaires. Différents gènes on été utilisés, et actuellement au Centre National de Référence nous réalisons une amplification génique de deux gènes spécifiques, le gène IS1111, et le gène IS30a , par une technique de PCR quantitative en temps réel à l'aide de sondes d'hydrolyse. Quel que soit le gène amplifié, la spécificité des fragments amplifiés doit être vérifiée, soit par séquençage, soit par hybridation avec une sonde spécifique.

Références

  1. Fenollar F, Fournier PE, Raoult D. Molecular detection of Coxiella burnetii in the sera of patients with Q fever endocarditis or vascular infection. J Clin Microbiol. 2004 Nov;42(11):4919-24.
  2. Fournier PE, Raoult D. Comparison of PCR and serology assays for early diagnosis of acute Q fever. J Clin Microbiol. 2003 Nov;41(11):5094-8.

22. Biologie moléculaire

Gènes et séquences des amorces utilisées


Gene Amorces Nom Amorces (séquences)
16S rRNA 16S1 CTCCTGGCGGCGAGAGTGGC
16S2N GTTAGCTTCGCTACTAAGAAGGGAACTTCCC
23S rRNA 976F AGGTCCTGGTGGAAAGGAACG
1446R TCTCATCTGCCGAACCCATTGC
16S-23S rRNA 16SF TTGTACACACCGCCCGTCA
internal transcribed spacer 23SR GGGTT(CGT)CCCCATTCGG
16SS GAAGTCGTAACAAGGTA
23SS TCTCGATGCCAAGGCATCCACC
Superoxyde dismutase CB1 ACTCAACGCACTGGAACGGC
CB2 TAGCTGAAGCCAATTCGCC
Plasmid QpRS QpRS01 CTCGTACCCAAAGACTATGAATATATC
QpRS02 CACATTGGGTATCGTACTGTCCCT
Plasmid QpH1 QpH11 TGACAAATAGAATTTCTTCATTTTGAT
QpH12 GCTTATTTTCTTCCTCGAATCTATGAAT
CbbE G4131 CTGATGTGTCAAGTAATGTCGG
G4132 CTTCATGGTTATGATTCTGCG
HtpAB Trans1 TATGTATCCACCGTAGCCAGTC
Trans2 CCCAACAACACCTCCTTATTC
IS 1111 Trans 3 CAACTGTGTGGAATTGATGAG
Trans 5 GCGCCATGAATCAATAACGT
IS1111F GCGTCATAATGCGCCAACATA
IS1111R CGCAGCCCACCTTAAGACTG
Sonde IS1111 6FAM-TGCTCAGTATGTATCCACCG-TAMRA
IS 30a Cbis30aF AATGTCTGCGGGAAATAGGC
Cbis30aR GAGGCCTTTTACCGGAATTC
Sonde IS30a 6FAM-TCGAGATCATAGCGTCATT-TAMRA

Référence

  1. Fenollar F, Raoult D. Molecular genetic methods for the diagnosis of fastidious microorganisms. APMIS. 2004 Nov-Dec;112(11-12):785-807. Review.

23. Cinétique des examens diagnostiques Fièvre Q aiguë

Au CNR, le diagnostic d'une fièvre Q aigue est retenu si : Titre des IgM ? 50 et titre des IgG ? 200 pour les anticorps anti-phase II La cinétique des anticorps et la phase de positivité de la PCR sont représentées ci-dessous :

Dans la fièvre Q aiguë, la PCR est généralement négative quand le titre des anticorps est élevé.

Référence

  1. Tissot-Dupont H, Thirion X, Raoult D. Q fever serology: cutoff determination for microimmunofluorescence. Clin Diagn Lab Immunol. 1994 Mar;1(2):189-96.
  2. Fournier PE, Raoult D. Comparison of PCR and serology assays for early diagnosis of acute Q fever. J Clin Microbiol. 2003 Nov;41(11):5094-8.

24. Cinétique des examens diagnostiques Fièvre Q chronique

Au CNR, le diagnostic d'une fièvre Q chronique est retenu si : Titre des IgG > 1600 pour les anticorps antiphase I Il faut noter toutefois que des titres d'IgG de phase I à 800 avec présence d'IgA de phase I peuvent être rencontrés dans certains cas de formes chroniques. Ce type de résultat sérologique doit donc être interprété en fonction des critères cliniques et après avis d'un spécialiste.

La cinétique des anticorps et la phase de positivité de la PCR sont représentées ci-dessous :

La PCR (et la culture de Coxiella burnetii) sont plus fréquemment positives dans l'endocardite quand les IgG anti- phase I sont élevées : l'association titre en IgG élevés et PCR positive doit faire évoquer la chronicité.

Références

  1. Tissot-Dupont H, Thirion X, Raoult D. Q fever serology: cutoff determination for microimmunofluorescence. Clin Diagn Lab Immunol. 1994 Mar;1(2):189-96.
  2. Fenollar F, Fournier PE, Raoult D. Molecular detection of Coxiella burnetii in the sera of patients with Q fever endocarditis or vascular infection. J Clin Microbiol. 2004 Nov;42(11):4919-24.

25. Culture

L'isolement de Coxiella burnetii à partir d'échantillon est réalisé sur cellules HEL, par la technique de centrifugation sur tube bijou (shell-vial), petit tube en polycarbonate avec un bouchon à vis. Au fond du tube se trouve une lamelle sur laquelle a été cultivé un tapis cellulaire.

Les manipulations relatives à l'utilisation de ces tubes bijoux sont réalisées sous hotte à flux laminaire dans un laboratoire de sécurité de niveau 3. Après inoculation et centrifugation à 700 g/min pendant 1 heure, l'inoculum est retiré et remplacé par du milieu de culture cellulaire.

La détection de la croissance bactérienne au niveau de la lamelle peut se faire directement dans le shell-vial. Les colorations peuvent être réalisées à partir du surnageant de culture après cyto-centrifugation ou en grattant quelques cellules de la monocouche cellulaire infectée. La détection des bactéries se fait par immunofluorescence.

L'identification de l'espèce bactérienne utilise les techniques de biologie moléculaire.

Références

  1. Marrero, M. and D. Raoult. 1989. Centrifugation-shell vial technique for rapid detection of Mediterranean spotted fever rickettsia in blood culture. Am J Trop Med Hyg 40:197-199.
  2. Gimenez, D. F. 1964. Staining rickettsiae in yolk-sac cultures. Stain Technol. 39:135-140.
  3. La Scola, B., G. Michel, and D. Raoult. 1997. Use of amplification and sequencing of the 16S rRNA gene to diagnose Mycoplasma pneumoniae osteomyelitis in a patient with hypogammaglobulinemia. Clin Infect Dis. 24:1161-1163.
  4. Hoover, T. A., M. H. Vodkin, and J. C. Williams. 1992. A Coxiella burnetii repeated DNA element resembling a bacterial insertion sequence. J.Bacteriol. 174:5540-5548.

26. Traitement : les antibiotiques

Le traitement de référence est la doxycycline associée à l'hydroxychloroquine (agent alcalinisant du phagolysosome cellulaire où Coxiella burnetii se multiplie) Le cotrimoxazole et la rifampicine sont utilisables en cas d'allergie ou de contre-indication. Les fluoroquinolones ont un effet variable L'érythrocine a une effficacité inconstante, autour de 30% Les nouveaux macrolides ont une efficacité in vitro

Références

  1. Raoult D. Treatment of Q fever. Antimicrob Agents Chemother. 1993 Sep;37(9):1733-6. Review.
  2. Boulos A, Rolain JM, Maurin M, Raoult D. Measurement of the antibiotic susceptibility of Coxiella burnetii using real time PCR. Int J Antimicrob Agents. 2004 Feb;23(2):169-74.
  3. Rolain JM, Maurin M, Raoult D. Bacteriostatic and bactericidal activities of moxifloxacin against Coxiella burnetii. Antimicrob Agents Chemother. 2001 Jan;45(1):301-2.
  4. Maurin M, Raoult D. Bacteriostatic and bactericidal activity of levofloxacin against Rickettsia rickettsii, Rickettsia conorii, 'Israeli spotted fever group rickettsia' and Coxiella burnetii. J Antimicrob Chemother. 1997 Jun;39(6):725-30.
  5. Raoult D. Use of macrolides for Q fever. Antimicrob Agents Chemother. 2003 Jan;47(1):446.
  6. Raoult D. Antimicrobial activity against obligate intracellular bacteria. Trends Microbiol. 2001 Jan;9(1):14.

27. Traitement de la fièvre Q aiguë

Fièvre Q aiguë symptomatique au moment du diagnostic

Traitement par doxycycline jusqu'à une semaine après l'apyrexie

Fièvre Q aiguë chez l'enfant

Il est maintenant admis que l'âge n'est pas une contre- indication à la doxycycline dans les pathologies où ce traitement est spécifique. Il a été montré que 3 traitements de 21 jours ne posent pas de problème dentaire.

Fièvre Q aiguë chez la femme enceinte

Traitement systématique par cotrimoxazole (Bactrim forte 2 cp/j) jusqu'à l'accouchement, avec ajout d'acide folinique et surveillance des effets secondaires hématologiques tous les 14 jours.

Références

  1. Raoult D. Treatment of Q fever. Antimicrob Agents Chemother. 1993 Sep;37(9):1733-6. Review.
  2. Herz G, Gfeller J. Vibramycin in paediatrics. An evaluation of the onset of action and efficacy.Chemotherapy. 1975;21 Suppl 1:58-67.
  3. Raoult D, Fenollar F, Stein A. Q fever during pregnancy: diagnosis, treatment, and follow-up. Arch Intern Med. 2002 Mar 25;162(6):701-4.

28. Traitement de la fièvre Q chronique

Traitement par doxycycline + hydroxychloroquine pour une durée de un an et demi à trois ans. La posologie initiale est de 200 mg /j pour la doxycycline et de 600 mg /j pour l'hydroxychloroquine.

Des dosages plasmatiques seront effectués. Les deux produits ont une demi-vie longue et un seul prélèvement (pas de pic et de résiduel) dans la journée est nécessaire.

La posologie de doxycycline est à adapter en fonction des taux plasmatiques qui doivent être supérieurs à 5 µg/ml. Si possible, la souche de Coxiella burnetii du patient sera cultivée (à partir du sang ou des valves cardiaques en cas d'intervention). La CMI de la doxycycline sera évaluée sur cette souche (résultat rendu à trois mois) pour ajuster les taux plasmatiques de doxycycline entre 1,5 et 2 fois la CMI.

La posologie de l'hydroxychloroquine est à adapter en fonction des taux plasmatiques qui doivent être de 1 ± 0,2 mg/l, et de la tolérance du patient. Elle est en général adaptée à 1 cp 2 fois / j après 3 à 6 mois, puis 1 cp à 1,5 cp / jour après 6 mois. L'efficacité du traitement se juge sur le suivi des titres d'anticorps : le critère d'efficacité est une diminution des titres d'anticorps IgA phase I et IgG phase I d'au moins deux dilutions après un an de traitement.

Références

  1. Raoult D, Houpikian P, Tissot Dupont H, Riss JM, Arditi-Djiane J, Brouqui P. Treatment of Q fever endocarditis: comparison of 2 regimens containing doxycycline and ofloxacin or hydroxychloroquine. Arch Intern Med. 1999 Jan 25;159(2):167-73.
  2. Rolain JM, Mallet MN, Raoult D. Correlation between serum doxycycline concentrations and serologic evolution in patients with Coxiella burnetii endocarditis. J Infect Dis. 2003 Nov 1;188(9):1322-5. Epub 2003 Oct 13.
  3. Rolain JM, Boulos A, Mallet MN, Raoult D. Correlation between ratio of doxyxycline to MIC and rapid decline of antibody levels during treatment of Q fever endocarditis. Antimicrob Agents Chemother. 2005. In press.

29. Traitement de la fièvre Q aiguë chez les sujets à risque

Tout patient présentant un facteur de risque d'évolution vers la chronicité (valvulopathies même minimes, prothèses valvulaires ou vasculaires, anévrismes, immunodépression (et en particulier lymphomes)), chez qui un diagnostic de fièvre Q aiguë est porté doit bénéficier d'un traitement systématique, selon le même protocole que les formes chroniques, pour une durée d'un an.

Référence

  1. Fenollar F, Fournier PE, Carrieri MP, Habib G, Messana T, Raoult D. Risks factors and prevention of Q fever endocarditis. Clin Infect Dis. 2001 Aug 1;33(3):312-6. Epub 2001 Jun 25.

30. Doxycycline + Hydroxychloroquine

Mode d'administration:

Surveillance de l'efficacité thérapeutique et de la toxicité

Surveillance en cours de traitement:

Contre-indications et toxicité du traitement

Doxycycline, VIBRAMYCINE®:

* : Il faut insister sur la nécessité, sous peine de brûlures, de protéger la face (chapeau, crème écran total) et les mains (gants) du soleil, en particulier l'été.

Hydroxy-chloroquine, PLAQUENIL®:

31. Cotrimoxazole

Mode d'administration:

ce traitement doit être poursuivi pendant toute la grossesse

Surveillance de l'efficacité thérapeutique et de la toxicité Surveillance en cours de traitement:

Contre-indications et toxicité du traitement Cotrimoxazole, BACTRIM®:

32. Est-il possible de prévenir la maladie?

Tout d'abord, il est indispensable de prévenir la survenue de formes chroniques chez les personnes présentant une fièvre Q aiguë.

Prévention de la transmission de Coxiella burnetii Il est possible de prévenir la survenue de la maladie chez l'homme et chez les animaux par la mise en place des mesures suivantes chez les sujets exposés.

Chez l'homme:


La prévention passe par le port systématique de masque pour le nettoyage des cages d'animaux et le changement de la litière. Dans la mesure ou la maladie humaine est susceptible de passer inaperçue, il est nécessaire de réaliser un sérodiagnostic systématique chez l'ensemble du personnel lors de survenue de fièvre Q chez un employé d'un élevage ou d'une entreprise exerçant des activités à risque. Les manipulations de prélèvements contenant des souches de Coxiella burnetii faisant courir des risques au personnel de laboratoire, ces prélèvements ne peuvent être manipulés que dans des laboratoires de type P3. Les femmes enceintes et les individus susceptibles de développer des formes chroniques ne doivent pas consommer de lait cru ou des produits laitiers au lait cru et éviter les contacts avec les animaux même de compagnie et les fermes pédagogiques

Chez les animaux:


Il est recommandé d'effectuer un dépistage sérologique systématique des animaux nouvellement introduits dans un élevage, de porter des gants et des masques lors de manipulations de rongeurs à statut sanitaire inconnu, et de désinfecter les cages. Dans les élevages contaminés, il est recommandé de pratiquer les mises bas en boxes séparés, de désinfecter les boxes, et de tremper les placentas dans de la chaux chlorée avant de les enterrer à 50 cm de profondeur. Enfin, une chimioprophylaxie par oxytétracycline peut être administrée aux animaux gestants non vaccinées.

33. Existe-t-il un vaccin ?

A l'heure actuelle, il existe un vaccin humain (Q-vax) qui n'est commercialisé qu'en Australie et n'est pas disponible en France.

34. Coxiella burnetii et bioterrorisme

Coxiella burnetii est parfaitement adaptée à un mode de transmission par aérosols grâce à sa capacité à survivre dans des environnements hostiles et à sa virulence. Ces caractéristiques ainsi que sa résistance aux principaux désinfectants et le fait que la dissémination d'aérosols peut se faire sur de grandes étendues en font un agent potentiel de bioterrorisme. La grande variété des réservoirs animaux fait qu'il est très facile d'obtenir ces souches. Enfin, un vaccin n'est disponible qu'en Australie et ses conditions d'administration rendent improbable son utilisation de masse. Le seul facteur limitant est que la maladie est le plus souvent bénigne ce qui fait que le principal impact d'une attaque bioterroriste utilsant Coxiella burnetii serait lié aux signes cliniques de la forme aiguë et à la panique engendrée par l'attaque. Le laboratoire dispose de PCR en temps réel permettant le diagnostic rapide de fièvre Q et donc d'identifier d'éventuels cas groupés pouvant faire soupçonner une attaque bioterroriste.

35. Contribution de l'IFR48 à la recherche sur le sujet

Publications 1986-2005

  1. Levy PY, Khan M, Raoult D. Acute pericarditis. N Engl J Med 2005; 352(11):1154-1155.
  2. Raoult D, Marrie T, Mege J. Natural history and pathophysiology of Q fever. Lancet Infect Dis 2005; 5(4):219-226.
  3. Rolain JM, Gouriet F, Brouqui P, Larrey D, Janbon F, Vene S, Jarnestrom V, Raoult D. Concomitant or consecutive infection with Coxiella burnetii and tickborne diseases. Clin Infect Dis 2005; 40(1):82-88.
  4. Stein A, Louveau C, Lepidi H, Ricci F, Baylac P, Davoust B, Raoult D. Q fever pneumonia: virulence of Coxiella burnetii pathovars in a murine model of aerosol infection. Infect Immun 2005; 73(4):2469-2477.
  5. Aboudharam G, Drancourt M, Raoult D. Culture of Coxiella burnetii from the dental pulp of experimentally infected guinea pigs. Microb Pathog 2004; 36(6):349-350.
  6. Brouqui P, Badiaga S, Raoult D. Q fever outbreak in homeless shelter. Emerg Infect Dis 2004; 10(7):1297-1299.
  7. Fenollar F, Fournier PE, Raoult D. Molecular detection of Coxiella burnetii in the sera of patients with Q fever endocarditis or vascular infection. J Clin Microbiol 2004; 42(11):4919-4924.
  8. Fenollar F, Raoult D. Molecular genetic methods for the diagnosis of fastidious microorganisms. APMIS 2004; 112(11-12):785-807.
  9. Foucault C, Lepidi H, Poujet-Abadie JF, Granel B, Roblot F, Ariga T, Raoult D. Q fever and lymphadenopathy: report of four new cases and review. Eur J Clin Microbiol Infect Dis 2004; 23(10):759-764.
  10. Ghigo E, Honstettre A, Capo C, Gorvel JP, Raoult D, Mege JL. Link between impaired maturation of phagosomes and defective Coxiella burnetii killing in patients with chronic Q fever. J Infect Dis 2004; 190(10):1767-1772.
  11. Gozalan A, Akin L, Rolain JM, Tapar FS, Oncul O, Yoshikura H, Zeller H, Raoult D, Esen B. [ Epidemiological evaluation of a possible outbreak in and nearby Tokat province ]. Mikrobiyol Bul 2004; 38(1-2):33-44.
  12. Honstettre A, Ghigo E, Moynault A, Capo C, Toman R, Akira S, Takeuchi O, Lepidi H, Raoult D, Mege JL. Lipopolysaccharide from Coxiella burnetii is involved in bacterial phagocytosis, filamentous actin reorganization, and inflammatory responses through Toll-like receptor 4. J Immunol 2004; 172(6):3695-3703.
  13. Leone M, Honstettre A, Lepidi H, Capo C, Bayard F, Raoult D, Mege JL. Effect of sex on Coxiella burnetii infection: protective role of 17beta-estradiol. J Infect Dis 2004; 189(2):339-345.
  14. Maltezou HC, Constantopoulou I, Kallergi C, Vlahou V, Georgakopoulos D, Kafetzis DA, Raoult D. Q fever in children in Greece. Am J Trop Med Hyg 2004; 70(5):540-544.
  15. Tissot-Dupont H, Amadei MA, Nezri M, Raoult D. Wind in November, Q fever in December. Emerg Infect Dis 2004; 10(7):1264-1269.
  16. Capo C, Moynault A, Collette Y, Olive D, Brown EJ, Raoult D, Mege JL. Coxiella burnetii avoids macrophage phagocytosis by interfering with spatial distribution of complement receptor 3. J Immunol 2003; 170(8):4217-4225.
  17. Fournier PE, Raoult D. Comparison of PCR and serology assays for early diagnosis of acute Q fever. J Clin Microbiol 2003; 41(11):5094-5098.
  18. Ghigo E, Imbert G, Capo C, Raoult D, Mege JL. Interleukin-4 induces Coxiella burnetii replication in human monocytes but not in macrophages. Ann N Y Acad Sci 2003; 990:450-459.
  19. Hatchette T, Campbell N, Hudson R, Raoult D, Marrie TJ. Natural history of Q fever in goats. Vector Borne Zoonotic Dis 2003; 3(1):11-15.
  20. Honstettre A, Imbert G, Ghigo E, Gouriet F, Capo C, Raoult D, Mege JL. Dysregulation of cytokines in acute Q fever: role of interleukin-10 and tumor necrosis factor in chronic evolution of Q fever. J Infect Dis 2003; 187(6):956-962.
  21. Langley JM, Marrie TJ, Leblanc JC, Almudevar A, Resch L, Raoult D. Coxiella burnetii seropositivity in parturient women is associated with adverse pregnancy outcomes. Am J Obstet Gynecol 2003; 189(1):228-232.
  22. Lepidi H, Houpikian P, Liang Z, Raoult D. Cardiac valves in patients with Q fever endocarditis: microbiological, molecular, and histologic studies. J Infect Dis 2003; 187(7):1097-1106.
  23. Levy PY, Corey R, Berger P, Habib G, Bonnet JL, Levy S, Messana T, Djiane P, Frances Y, Botta C, DeMicco P, Dumon H, Mundler O, Chomel JJ, Raoult D. Etiologic diagnosis of 204 pericardial effusions. Medicine (Baltimore) 2003; 82(6):385-391.
  24. Raoult D. Use of macrolides for Q fever. Antimicrob Agents Chemother 2003; 47(1):446.
  25. Rolain JM, Lecam C, Raoult D. Simplified serological diagnosis of endocarditis due to Coxiella burnetii and Bartonella. Clin Diagn Lab Immunol 2003; 10(6):1147-1148.
  26. Rolain JM, Lepidi H, Harle JR, Allegre T, Dorval ED, Khayat Z, Raoult D. Acute acalculous cholecystitis associated with Q fever: report of seven cases and review of the literature. Eur J Clin Microbiol Infect Dis 2003; 22(4):222-227.
  27. Rolain JM, Mallet MN, Raoult D. Correlation between serum doxycycline concentrations and serologic evolution in patients with Coxiella burnetii endocarditis. J Infect Dis 2003; 188(9):1322-1325.
  28. Scrimgeour EM, Al Ismaily SI, Rolain JM, Al Dhahry SH, El Khatim HS, Raoult D. Q Fever in human and livestock populations in Oman. Ann N Y Acad Sci 2003; 990:221-225.
  29. Suputtamongkol Y, Rolain JM, Losuwanaruk K, Niwatayakul K, Suttinont C, Chierakul W, Pimda K, Raoult D. Q fever in Thailand. Emerg Infect Dis 2003; 9(9):1186-1187.
  30. Werner M, Fournier PE, Andersson R, Hogevik H, Raoult D. Bartonella and Coxiella antibodies in 334 prospectively studied episodes of infective endocarditis in Sweden. Scand J Infect Dis 2003; 35(10):724-727.
  31. Bernit E, Pouget J, Janbon F, Dutronc H, Martinez P, Brouqui P, Raoult D. Neurological involvement in acute Q fever: a report of 29 cases and review of the literature. Arch Intern Med 2002; 162(6):693-700.
  32. Carrieri MP, Tissot-Dupont H, Rey D, Brousse P, Renard H, Obadia Y, Raoult D. Investigation of a slaughterhouse-related outbreak of Q fever in the French Alps. Eur J Clin Microbiol Infect Dis 2002; 21(1):17-21.
  33. Dellacasagrande J, Ghigo E, Raoult D, Capo C, Mege JL. IFN-gamma-induced apoptosis and microbicidal activity in monocytes harboring the intracellular bacterium Coxiella burnetii require membrane TNF and homotypic cell adherence. J Immunol 2002; 169(11):6309-6315.
  34. Ghigo E, Capo C, Tung CH, Raoult D, Gorvel JP, Mege JL. Coxiella burnetii survival in THP-1 monocytes involves the impairment of phagosome maturation: IFN-gamma mediates its restoration and bacterial killing. J Immunol 2002; 169(8):4488-4495.
  35. Houpikian P, Habib G, Mesana T, Raoult D. Changing clinical presentation of Q fever endocarditis. Clin Infect Dis 2002; 34(5):E28-E31.
  36. Maltezou HC, Raoult D. Q fever in children. Lancet Infect Dis 2002; 2(11):686-691.
  37. Marrie TJ, Raoult D. Update on Q fever, including Q fever endocarditis. Curr Clin Top Infect Dis 2002; 22:97-124.
  38. Raoult D. Q fever: still a mysterious disease. QJM 2002; 95(8):491-492.
  39. Raoult D, Fenollar F, Stein A. Q fever during pregnancy: diagnosis, treatment, and follow-up. Arch Intern Med 2002; 162(6):701-704.
  40. Salamand AC, Collart F, Caus T, Casalta JP, Mouly-Bandini A, Monties JR, Habib G, Raoult D, Mesana TG. Q fever endocarditis: over 14 years of surgical experience in a referral center for rickettsioses. J Heart Valve Dis 2002; 11(1):84-90.
  41. Fenollar F, Lepidi H, Raoult D. Whipple's endocarditis: review of the literature and comparisons with Q fever, Bartonella infection, and blood culture-positive endocarditis. Clin Infect Dis 2001; 33(8):1309-1316.
  42. Fenollar F, Fournier PE, Carrieri MP, Habib G, Messana T, Raoult D. Risks factors and prevention of Q fever endocarditis. Clin Infect Dis 2001; 33(3):312-316.
  43. Fournier PE, Etienne J, Harle JR, Habib G, Raoult D. Myocarditis, a rare but severe manifestation of Q fever: report of 8 cases and review of the literature. Clin Infect Dis 2001; 32(10):1440-1447.
  44. Ghigo E, Capo C, Raoult D, Mege JL. Interleukin-10 stimulates Coxiella burnetii replication in human monocytes through tumor necrosis factor down-modulation: role in microbicidal defect of Q fever. Infect Immun 2001; 69(4):2345-2352.
  45. Hatchette TF, Hudson RC, Schlech WF, Campbell NA, Hatchette JE, Ratnam S, Raoult D, Donovan C, Marrie TJ. Goat-associated Q fever: a new disease in Newfoundland. Emerg Infect Dis 2001; 7(3):413-419.
  46. La Scola B, Raoult D. Survival of Coxiella burnetii within free-living amoeba Acanthamoeba castellanii. Clin Microbiol Infect 2001; 7(2):75-79.
  47. Meconi S, Capo C, Remacle-Bonnet M, Pommier G, Raoult D, Mege JL. Activation of protein tyrosine kinases by Coxiella burnetii: role in actin cytoskeleton reorganization and bacterial phagocytosis. Infect Immun 2001; 69(4):2520-2526.
  48. Parola P, Raoult D. Ticks and tickborne bacterial diseases in humans: an emerging infectious threat. Clin Infect Dis 2001; 32(6):897-928.
  49. Rolain JM, Maurin M, Raoult D. Bacteriostatic and bactericidal activities of moxifloxacin against Coxiella burnetii. Antimicrob Agents Chemother 2001; 45(1):301-302.
  50. Aboudharam G, Lascola B, Raoult D, Drancourt M. Detection of Coxiella burnetii DNA in dental pulp during experimental bacteremia. Microb Pathog 2000; 28(4):249-254.
  51. Dellacasagrande J, Ghigo E, Capo C, Raoult D, Mege JL. Coxiella burnetii survives in monocytes from patients with Q fever endocarditis: involvement of tumor necrosis factor. Infect Immun 2000; 68(1):160-164.
  52. Dellacasagrande J, Ghigo E, Hammami SM, Toman R, Raoult D, Capo C, Mege JL. alpha(v)beta(3) integrin and bacterial lipopolysaccharide are involved in Coxiella burnetii-stimulated production of tumor necrosis factor by human monocytes. Infect Immun 2000; 68(10):5673-5678.
  53. Ghigo E, Capo C, Amirayan N, Raoult D, Mege J. The 75-kD tumour necrosis factor (TNF) receptor is specifically up-regulated in monocytes during Q fever endocarditis. Clin Exp Immunol 2000; 121(2):295-301.
  54. Raoult D, Tissot-Dupont H, Foucault C, Gouvernet J, Fournier PE, Bernit E, Stein A, Nesri M, Harle JR, Weiller PJ. Q fever 1985-1998. Clinical and epidemiologic features of 1,383 infections. Medicine (Baltimore) 2000; 79(2):109-123.
  55. Rey D, Obadia Y, Tissot-Dupont H, Raoult D. Seroprevalence of antibodies to Coxiella burnetti among pregnant women in South Eastern France. Eur J Obstet Gynecol Reprod Biol 2000; 93(2):151-156.
  56. Stein A, Lepidi H, Mege JL, Marrie TJ, Raoult D. Repeated pregnancies in BALB/c mice infected with Coxiella burnetii cause disseminated infection, resulting in stillbirth and endocarditis. J Infect Dis 2000; 181(1):188-194.
  57. Capo C, Lindberg FP, Meconi S, Zaffran Y, Tardei G, Brown EJ, Raoult D, Mege JL. Subversion of monocyte functions by Coxiella burnetii: impairment of the cross-talk between alphavbeta3 integrin and CR3. J Immunol 1999; 163(11):6078-6085.
  58. Capo C, Amirayan N, Ghigo E, Raoult D, Mege J. Circulating cytokine balance and activation markers of leucocytes in Q fever. Clin Exp Immunol 1999; 115(1):120-123.
  59. Dellacasagrande J, Capo C, Raoult D, Mege JL. IFN-gamma-mediated control of Coxiella burnetii survival in monocytes: the role of cell apoptosis and TNF. J Immunol 1999; 162(4):2259-2265.
  60. Fournier PE, Raoult D. Predominant immunoglobulin A response to phase II antigen of Coxiella burnetii in acute Q fever. Clin Diagn Lab Immunol 1999; 6(2):173-177.
  61. Granel B, Genty I, Serratrice J, Rey J, Disdier P, Raoult D, Weiller PJ. Livedo reticularis revealing a latent infective endocarditis due to Coxiella burnetti. J Am Acad Dermatol 1999; 41(5 Pt 2):842-844.
  62. Habib G, Derumeaux G, Avierinos JF, Casalta JP, Jamal F, Volot F, Garcia M, Lefevre J, Biou F, Maximovitch-Rodaminoff A, Fournier PE, Ambrosi P, Velut JG, Cribier A, Harle JR, Weiller PJ, Raoult D, Luccioni R. Value and limitations of the Duke criteria for the diagnosis of infective endocarditis. J Am Coll Cardiol 1999; 33(7):2023-2029.
  63. Levy PY, Carrieri P, Raoult D. Coxiella burnetii pericarditis: report of 15 cases and review. Clin Infect Dis 1999; 29(2):393-397.
  64. Maurin M, Raoult D. Q fever. Clin Microbiol Rev 1999; 12(4):518-553.
  65. Raoult D, Houpikian P, Tissot DH, Riss JM, Arditi-Djiane J, Brouqui P. Treatment of Q fever endocarditis: comparison of 2 regimens containing doxycycline and ofloxacin or hydroxychloroquine. Arch Intern Med 1999; 159(2):167-173.
  66. Sekeyova Z, Roux V, Raoult D. Intraspecies diversity of Coxiella burnetii as revealed by com1 and mucZ sequence comparison. FEMS Microbiol Lett 1999; 180(1):61-67.
  67. Stein A, Raoult D. Pigeon pneumonia in provence: a bird-borne Q fever outbreak. Clin Infect Dis 1999; 29(3):617-620.
  68. Stein A, Berthet B, Raoult D. A "query" pancreatitis in a young shepherdess: an uncommon manifestation of acute Q fever. Clin Infect Dis 1999; 29(2):445-446.
  69. Tissot-Dupont H, Torres S, Nezri M, Raoult D. Hyperendemic focus of Q fever related to sheep and wind. Am J Epidemiol 1999; 150(1):67-74.
  70. Boni M, Davoust B, Tissot-Dupont H, Raoult D. Survey of seroprevalence of Q fever in dogs in the southeast of France, French Guyana, Martinique, Senegal and the Ivory Coast. Vet Microbiol 1998; 64(1):1-5.
  71. Capo C, Iorgulescu I, Mutillod M, Mege JL, Raoult D. Increases in the levels of Coxiella burnetii-specific immunoglobulin G1 and G3 antibodies in acute Q fever and chronic Q fever. Clin Diagn Lab Immunol 1998; 5(6):814-816.
  72. Cathebras P, Brouqui P, Philippe P, Raoult D, Rousset H. [ Splenic abscess caused by Coxiella burnetti in the absence of endocarditis ]. Rev Med Interne 1998; 19(10):740-742.
  73. Fournier PE, Casalta JP, Piquet P, Tournigand P, Branchereau A, Raoult D. Coxiella burnetii infection of aneurysms or vascular grafts: report of seven cases and review. Clin Infect Dis 1998; 26(1):116-121.
  74. Fournier PE, Marrie TJ, Raoult D. Diagnosis of Q fever. J Clin Microbiol 1998; 36(7):1823-1834.
  75. La Scola B, Lepidi H, Maurin M, Raoult D. A guinea pig model for Q fever endocarditis. J Infect Dis 1998; 178(1):278-281.
  76. Meconi S, Jacomo V, Boquet P, Raoult D, Mege JL, Capo C. Coxiella burnetii induces reorganization of the actin cytoskeleton in human monocytes. Infect Immun 1998; 66(11):5527-5533.
  77. Niang M, Parola P, Tissot-Dupont H, Baidi L, Brouqui P, Raoult D. Prevalence of antibodies to Rickettsia conorii Ricketsia africae, Rickettsia typhi and Coxiella burnetii in Mauritania. Eur J Epidemiol 1998; 14(8):817-818.
  78. Stein A, Raoult D. Q fever during pregnancy: a public health problem in southern France. Clin Infect Dis 1998; 27(3):592-596.
  79. Tellez A, Sanz MJ, Valkova D, Domingo C, Anda P, de Ory F, Albarran F, Raoult D. Q fever in pregnancy: case report after a 2-year follow-up. J Infect 1998; 37(1):79-81.
  80. Anstey NM, Tissot DH, Hahn CG, Mwaikambo ED, McDonald MI, Raoult D, Sexton DJ. Seroepidemiology of Rickettsia typhi, spotted fever group rickettsiae, and Coxiella burnetii infection in pregnant women from urban Tanzania. Am J Trop Med Hyg 1997; 57(2):187-189.
  81. Armengaud A, Kessalis N, Desenclos JC, Maillot E, Brousse P, Brouqui P, Tixier-Dupont H, Raoult D, Provensal P, Obadia Y. Urban outbreak of Q fever, Briancon, France, March to June 1996. Euro Surveill 1997; 2(2):12-13.
  82. Chevalier P, Vandenesch F, Brouqui P, Kirkorian G, Tabib A, Etienne J, Raoult D, Loire R, Touboul P. Fulminant myocardial failure in a previously healthy young man. Circulation 1997; 95(6):1654-1657.
  83. La Scola B, Lepidi H, Raoult D. Pathologic changes during acute Q fever: influence of the route of infection and inoculum size in infected guinea pigs. Infect Immun 1997; 65(6):2443-2447.
  84. Matthewman L, Kelly P, Hayter D, Downie S, Wray K, Bryson N, Rycroft A, Raoult D. Exposure of cats in southern Africa to Coxiella burnetii, the agent of Q fever. Eur J Epidemiol 1997; 13(4):477-479.
  85. Maurin M, Raoult D. Bacteriostatic and bactericidal activity of levofloxacin against Rickettsia rickettsii, Rickettsia conorii, 'Israeli spotted fever group rickettsia' and Coxiella burnetii. J Antimicrob Chemother 1997; 39(6):725-730.
  86. Mege JL, Maurin M, Capo C, Raoult D. Coxiella burnetii: the 'query' fever bacterium. A model of immune subversion by a strictly intracellular microorganism. FEMS Microbiol Rev 1997; 19(4):209-217.
  87. Musso D, Raoult D. Serological cross-reactions between Coxiella burnetii and Legionella micdadei. Clin Diagn Lab Immunol 1997; 4(2):208-212.
  88. Sabatier F, Dignat-George F, Mege JL, Brunet C, Raoult D, Sampol J. CD4+ T-cell lymphopenia in Q fever endocarditis. Clin Diagn Lab Immunol 1997; 4(1):89-92.
  89. Sanmarco M, Soler C, Christides C, Raoult D, Weiller PJ, Gerolami V, Bernard D. Prevalence and clinical significance of IgG isotype anti-beta 2-glycoprotein I antibodies in antiphospholipid syndrome: a comparative study with anticardiolipin antibodies. J Lab Clin Med 1997; 129(5):499-506.
  90. Stein A, Kruszewska D, Gouvernet J, Raoult D. Study of the 16S-23S ribosomal DNA internal spacer of Coxiella burnetii. Eur J Epidemiol 1997; 13(4):471-475.
  91. Capo C, Zugun F, Stein A, Tardei G, Lepidi H, Raoult D, Mege JL. Upregulation of tumor necrosis factor alpha and interleukin-1 beta in Q fever endocarditis. Infect Immun 1996; 64(5):1638-1642.
  92. Capo C, Zaffran Y, Zugun F, Houpikian P, Raoult D, Mege JL. Production of interleukin-10 and transforming growth factor beta by peripheral blood mononuclear cells in Q fever endocarditis. Infect Immun 1996; 64(10):4143-4147.
  93. Fournier PE, Casalta JP, Habib G, Messana T, Raoult D. Modification of the diagnostic criteria proposed by the Duke Endocarditis Service to permit improved diagnosis of Q fever endocarditis. Am J Med 1996; 100(6):629-633.
  94. La Scola B, Raoult D. Serological cross-reactions between Bartonella quintana, Bartonella henselae, and Coxiella burnetii. J Clin Microbiol 1996; 34(9):2270-2274.
  95. Marrie TJ, Stein A, Janigan D, Raoult D. Route of infection determines the clinical manifestations of acute Q fever. J Infect Dis 1996; 173(2):484-487.
  96. Matthewman LA, Rycroft AN, Kelly PJ, Hayter D, Downie S, Wray K, Bryson NR, Raoult D. Exposure of cats in southern Africa to Coxiella burnetii, the agent of Q fever. S Afr Med J 1996; 86(1):94-95.
  97. Raoult D. Q fever: still a query after all these years. J Med Microbiol 1996; 44(2):77-78.
  98. Vacher-Coponat H, Dussol B, Raoult D, Casanova P, Berland Y. Proliferative glomerulonephritis revealing chronic Q fever. Am J Nephrol 1996; 16(2):159-161.
  99. Cottalorda J, Jouve JL, Bollini G, Touzet P, Poujol A, Kelberine F, Raoult D. Osteoarticular infection due to Coxiella burnetii in children. J Pediatr Orthop B 1995; 4(2):219-221.
  100. Tissot Dupont H, Brouqui P, Faugere B, Raoult D. Prevalence of antibodies to Coxiella burnetii, Rickettsia conorii, and Rickettsia typhi in seven African countries. Clin Infect Dis 1995; 21(5):1126-1133.
  101. Letaief AO, Yacoub S, Dupont HT, Le Cam C, Ghachem L, Jemni L, Raoult D. Seroepidemiological survey of infections among blood donors in central Tunisia. Trans R Soc Trop Med Hyg 1995; 89(3):266-268.
  102. Moustaghfir A, Deharo JC, Tissot-Dupont H, Macaluso G, Raoult D, Djiane P. [ Acute pericarditis in Coxiella burnetti infection. Apropos of a case ]. Arch Mal Coeur Vaiss 1995; 88(11):1657-1659.
  103. Musso D, Raoult D. Coxiella burnetii blood cultures from acute and chronic Q-fever patients. J Clin Microbiol 1995; 33(12):3129-3132.
  104. Raoult D, Marrie T. Q fever. Clin Infect Dis 1995; 20(3):489-495.
  105. Stein A, Raoult D. Q fever endocarditis. Eur Heart J 1995; 16 Suppl B:19-23.
  106. Valero F, de Groote P, Millaire A, Raoult D, Wattre P, Ducloux G. Pericardial effusion as the initial feature of Q fever. Am Heart J 1995; 130(6):1308-1309.
  107. Brouqui P, Raoult D. Coxiella burnetii serology in granulomatous hepatitis. J Infect 1994; 28(2):229-230.
  108. Brouqui P, Dumler JS, Raoult D. Immunohistologic demonstration of Coxiella burnetii in the valves of patients with Q fever endocarditis. Am J Med 1994; 97(5):451-458.
  109. Dupont HT, Thirion X, Raoult D. Q fever serology: cutoff determination for microimmunofluorescence. Clin Diagn Lab Immunol 1994; 1(2):189-196.
  110. Leonetti F, Raoult D, Dussol B, Brunet P, Berland Y. Chronic Q fever in hemodialysis patients. Nephron 1994; 67(2):231-233.
  111. Piquet P, Raoult D, Tranier P, Mercier C. Coxiella burnetii infection of pseudoaneurysm of an aortic bypass graft with contiguous vertebral osteomyelitis. J Vasc Surg 1994; 19(1):165-168.
  112. Raoult D, Laurent JC, Mutillod M. Monoclonal antibodies to Coxiella burnetii for antigenic detection in cell cultures and in paraffin-embedded tissues. Am J Clin Pathol 1994; 101(3):318-320.
  113. Yu X, Raoult D. Serotyping Coxiella burnetii isolates from acute and chronic Q fever patients by using monoclonal antibodies. FEMS Microbiol Lett 1994; 117(1):15-19.
  114. Chevalier P, Moncada E, Kirkorian G, Touboul P, Etienne J, Raoult D. Q fever-induced EMF. Am Heart J 1993; 125(6):1818-1819.
  115. Fernandez-Martin J, Raoult D, Normand JP, Leport C. [ Endocarditis due to Q fever ]. Med Clin (Barc ) 1993; 101(16):639.
  116. Kelly PJ, Matthewman LA, Mason PR, Raoult D. Q fever in Zimbabwe. A review of the disease and the results of a serosurvey of humans, cattle, goats and dogs. S Afr Med J 1993; 83(1):21-25.
  117. Maurin M, Raoult D. In vitro susceptibilities of spotted fever group rickettsiae and Coxiella burnetii to clarithromycin. Antimicrob Agents Chemother 1993; 37(12):2633-2637.
  118. Raoult D, Levy PY, Dupont HT, Chicheportiche C, Tamalet C, Gastaut JA, Salducci J. Q fever and HIV infection. AIDS 1993; 7(1):81-86.
  119. Raoult D. Treatment of Q fever. Antimicrob Agents Chemother 1993; 37(9):1733-1736.
  120. Rhode C, Kelly PJ, Raoult D. Dairy cows as reservoirs of Coxiella burnetii in Zimbabwe. Cent Afr J Med 1993; 39(10):208-210.
  121. Stein A, Raoult D. Lack of pathotype specific gene in human Coxiella burnetii isolates. Microb Pathog 1993; 15(3):177-185.
  122. Tissot DH, Raoult D. [ Tick-borne diseases ]. Rev Med Interne 1993; 14(5):300-306.
  123. Brouqui P, Raoult D, Gabriel B. Chronic Coxiella burnetii infection mimicking malignant hematologic disease. Am J Hematol 1992; 39(4):309.
  124. Finidori JP, Raoult D, Bornstein N, Fleurette J. Study of cross-reaction between Coxiella burnetii and Legionella pneumophila using indirect immunofluorescence assay and immunoblotting. Acta Virol 1992; 36(5):459-465.
  125. Fishbein DB, Raoult D. A cluster of Coxiella burnetii infections associated with exposure to vaccinated goats and their unpasteurized dairy products. Am J Trop Med Hyg 1992; 47(1):35-40.
  126. Kuhne F, Morlat P, Riss I, Dominguez M, Hostyn P, Carniel N, Paix MA, Aubertin J, Raoult D, Le Rebeller MJ. [ Is A29, B12 vasculitis caused by the Q fever agent? (Coxiella burnetii) ]. J Fr Ophtalmol 1992; 15(5):315-321.
  127. Maurin M, Benoliel AM, Bongrand P, Raoult D. Phagolysosomes of Coxiella burnetii-infected cell lines maintain an acidic pH during persistent infection. Infect Immun 1992; 60(12):5013-5016.
  128. Raoult D, Brouqui P, Marchou B, Gastaut JA. Acute and chronic Q fever in patients with cancer. Clin Infect Dis 1992; 14(1):127-130.
  129. Stein A, Raoult D. Phenotypic and genotypic heterogeneity of 8 new human Coxiella burnetti isolates. Acta Virol 1992; 36(1):7-12.
  130. Stein A, Raoult D. Detection of Coxiella burnetti by DNA amplification using polymerase chain reaction. J Clin Microbiol 1992; 30(9):2462-2466.
  131. Tissot DH, Raoult D, Brouqui P, Janbon F, Peyramond D, Weiller PJ, Chicheportiche C, Nezri M, Poirier R. Epidemiologic features and clinical presentation of acute Q fever in hospitalized patients: 323 French cases. Am J Med 1992; 93(4):427-434.
  132. Drancourt M, Raoult D, Xeridat B, Milandre L, Nesri M, Dano P. Q fever meningoencephalitis in five patients. Eur J Epidemiol 1991; 7(2):134-138.
  133. Levy PY, Drancourt M, Etienne J, Auvergnat JC, Beytout J, Sainty JM, Goldstein F, Raoult D. Comparison of different antibiotic regimens for therapy of 32 cases of Q fever endocarditis. Antimicrob Agents Chemother 1991; 35(3):533-537.
  134. Micoud M, Brion JP, Boulard JC, Magne JL, Gratacap B, Stahl JP, Farah I, Raoult D. Infection of aortic aneurysm with Coxiella burnetii. Lancet 1991; 338(8766):584.
  135. Raoult D. Antibiotic treatment of rickettsiosis, recent advances and current concepts. Eur J Epidemiol 1991; 7(3):276-281.
  136. Dano P, Gayraud D, Martet G, Drancourt M, Raoult D. [ Meningoencephalitis caused by Coxiella burnetii ]. Rev Neurol (Paris) 1990; 146(8-9):511-513.
  137. Raoult D, Vestris G, Enea M. Isolation of 16 strains of Coxiella burnetii from patients by using a sensitive centrifugation cell culture system and establishment of the strains in HEL cells. J Clin Microbiol 1990; 28(11):2482-2484.
  138. Raoult D. Host factors in the severity of Q fever. Ann N Y Acad Sci 1990; 590:33-38.
  139. Raoult D, Levy PY, Harle JR, Etienne J, Massip P, Goldstein F, Micoud M, Beytout J, Gallais H, Remy G, . Chronic Q fever: diagnosis and follow-up. Ann N Y Acad Sci 1990; 590:51-60.
  140. Raoult D, Drancourt M, Vestris G. Bactericidal effect of doxycycline associated with lysosomotropic agents on Coxiella burnetii in P388D1 cells. Antimicrob Agents Chemother 1990; 34(8):1512-1514.
  141. Janbon F, Raoult D, Reynes J, Bertrand A. Concomitant human infection due to Rickettsia conorii and Coxiella burnetii. J Infect Dis 1989; 160(2):354-355.
  142. Levy P, Raoult D, Razongles JJ. Q-fever and autoimmunity. Eur J Epidemiol 1989; 5(4):447-453.
  143. Raoult D, Bollini G, Gallais H. Osteoarticular infection due to Coxiella burnetii. J Infect Dis 1989; 159(6):1159-1160.
  144. Raoult D. Antibiotic susceptibility of rickettsia and treatment of rickettsioses. Eur J Epidemiol 1989; 5(4):432-435.
  145. Raoult D, Yeaman MR, Baca OG. Susceptibility of Coxiella burnetii to pefloxacin and ofloxacin in ovo and in persistently infected L929 cells. Antimicrob Agents Chemother 1989; 33(5):621-623.
  146. Etienne J, Delahaye F, Raoult D, Frieh JP, Loire R, Delaye J. Acute heart failure due to Q fever endocarditis. Eur Heart J 1988; 9(8):923-926.
  147. Raoult D, Urvolgyi J, Etienne J, Roturier M, Puel J, Chaudet H. Diagnosis of endocarditis in acute Q-fever by immunofluorescence serology. Acta Virol 1988; 32(1):70-74.
  148. Raoult D, Toga B, Chaudet H, Chiche-Portiche C. Rickettsial antibody in southern France: antibodies to Rickettsia conorii and Coxiella burnetii among urban, suburban and semi-rural blood donors. Trans R Soc Trop Med Hyg 1987; 81(1):80-81.
  149. Raoult D, Etienne J, Massip P, Iaocono S, Prince MA, Beaurain P, Benichou S, Auvergnat JC, Mathieu P, Bachet P. Q fever endocarditis in the south of France. J Infect Dis 1987; 155(3):570-573.
  150. Raoult D, Piquet P, Gallais H, de Micco C, Drancourt M, Casanova P. Coxiella burnetii infection of a vascular prosthesis. N Engl J Med 1986; 315(21):1358-1359.

36. Correspondants au sein de l'IFR48

Unité des Rickettsies
Centre National de Référence
CNRS UMR 6020
Faculté de Médecine
27, bd Jean Moulin
13385 Marseille cedex 5

Tel : +33 (0)4 91 32 43 75
Fax : +33 (0)4 91 38 77 72

Diagnostic

Enquêtes épidémiologiques

Consultations au sein de la fédération de Microbiologie - Marseille

Le Pr Didier RAOULT (ou un de ses collaborateurs) assure une consultation hebdomadaire tous les mercredis matin

Fédération de Microbiologie
Hôpital de la Timone
264, rue Saint Pierre
13385 Marseille cedex 5

sur rendez-vous auprès de son secrétariat

Tel : +33 (0)4 91 38 55 17

didier.raoult@medecine.univ-mrs.fr

36.1. Quels prélèvements envoyer et comment les envoyer ?

Pneumopathie fébrile/Hépatite fébrile

Endocardite

Femme enceinte

Prélèvements anciens et blocs de paraffine peuvent être utiles au diagnostic (Anatomopathologie - Immunohistochimie - PCR)