1. Introduction
Rickettsia conorii subsp. conorii est responsable de la fièvre boutonneuse méditerranéenne, principale rickettsiose dans le bassin méditerranéen et également endémique en Afrique [ 1 ]. La fièvre boutonneuse méditerranéenne, décrite en 1909 par Conor et Bruch, est une zoonose, transmise par la piqûre de la tique brune du chien Rhipicephalus sanguineus. L'association fièvre - éruption cutanée - tâche noire (lésion nécrotique d'inoculation au site de la piqûre de la tique) en été, en zone d'endémie doit systématiquement faire évoquer le diagnostic. Cette maladie est le plus souvent bénigne mais peut dans 6% des cas s'accompagner de complications graves [ 2 ].
Références
- Raoult D, Weiller PJ, Chagnon A, Chaudet H, Gallais H, Casanova P (1986) Mediterranean spotted fever: clinical, laboratory and epidemiological features of 199 cases. Am J Trop Med Hyg 35: 845-850.
- Raoult D, Zuchelli P, Weiller PJ, Charrel C, San Marco JL, Gallais H, Casanova P (1986) Incidence, clinical observations and risk factors in the severe form of Mediterranean spotted fever among patients admitted to hospital in Marseille 1983-1984. J Infect 12: 111-116.
2. Que sait-on du micro-organisme ?
Rickettsia conorii (R. conorii) subsp. conorii est une bactérie intracellulaire stricte classée dans la sous-division ? des Proteobacteria et dans le groupe boutonneux des rickettsies. R. conorii subsp. conorii est responsable de la fièvre boutonneuse méditerranéenne. Bien que possédant une paroi de type Gram négatif, cette bactérie prend mal la coloration de Gram. Elle est colorée par la coloration de Gimenez. Dans sa cellule cible, la cellule endothéliale, R. conorii subsp. conorii est mobile par polymérisation des filaments d'actine cellulaire [ 1 ]. Le génome de R. conorii subsp. conorii a été entièrement séquencé. De petite taille (1,26 Mb), il est caractérisé par un nombre élevé de séquences répétées et de gènes en voie de dégradation [ 2 ]. R. conorii subsp. conorii est classée parmi les micro-organismes de niveau de sécurité biologique 3.
Références
- Raoult D, Zuchelli P, Weiller PJ, Charrel C, San Marco JL, Gallais H, Casanova P (1986) Incidence, clinical observations and risk factors in the severe form of Mediterranean spotted fever among patients admitted to hospital in Marseille 1983-1984. J Infect 12: 111-116.
- Teysseire N, Chiche-Portiche C, Raoult D (1992) Intracellular movements of Rickettsia conorii and R. typhi based on actin polymerization. Res Microbiol 143: 821-829.
R. conorii subsp. conorii à l'intérieur d'une cellule endothéliale humaines. Coloration de Gimenez.
Arbre phylogénique des bactéries du genre Rickettsia basée sur la comparaison des séquences du gène codant la citrate synthase.
3. Les sous-espèces de Rickettsia conorii
La taxonomie de R. conorii a longtemps été confuse. Plusieurs souches proches de R. conorii (Indian tick typhus rickettsia, Israeli spotted fever rickettsia, Astrakhan fever rickettsia) ont successivement été proposées comme espèces nouvelles ou comme membres d'un «complexe R. conorii». Récemment, des critères génotypiques ont permis de montrer que ces souches appartiennent à l'espèce R. conorii [ 5 ]. De plus, ces souches possédant une capital génétique similaire mais des particularités épidémio-cliniques et génomiques (Tableau 1) [ 6 ], la création de quatre sous-espèces de R. conorii a été proposée.
Références
- Fournier PE, Dumler JS, Greub G, Zhang J, Yimin W, Raoult D (2003) Gene sequence-based criteria for the identification of new Rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov. J Clin Microbiol 41: 5456-5465.
- Zhu Y, Fournier PE, Eremeeva M, Raoult D (2005) Proposal to create subspecies of Rickettsia conorii based on multi-locus sequence typing and an emended description of Rickettsia conorii. BMC Microbiol 5: 11.
Tableau 1: Caractéristiques comparées des maladies causées par les sous-espèces de R. conorii.
| Sous-espèce |
Vecteur |
Zone d'endémie |
Nom de la maladie |
Fièvre (%) |
Escarre d'inoculation (%) |
Eruption cutanée (%) |
Formes mortelles |
Références |
| R. conorii subsp. conorii isolats Malish, Moroccan R. conorii subsp. conorii isolat Kenya |
Rhipicephalus sp., Haemaphysali s leachii |
Bassin méditerranéen, Afrique |
Fièvre boutonneuse méditerranéenne, Kenyan tick typhus, South African tick bite fever |
100 |
72 |
97 |
Oui |
[ 1,2 ] |
| R. conorii subsp. indica |
Rhipicephalus sanguineus, Boophilus microplus, Haemaphysalis leachii |
Inde, Pakistan |
Indian tick typhus |
100 |
0 |
100 |
Non |
[ 3 ] |
| R. conorii subsp. caspia |
Rhipicephalus sanguineus, R. pumilio |
Astrakhan region,Tchad, Kosovo |
Astrakhan fever |
100 |
23-28 |
100 |
Non |
[ 4-8 ] |
| R. conorii subsp. israelensis |
Rhipicephalus sanguineus |
Israël, Portugal |
Israeli spotted fever |
100 |
0 |
100 |
Oui |
[ 9 ] |
Références
- Raoult D, Weiller PJ, Chagnon A, Chaudet H, Gallais H, Casanova P (1986) Mediterranean spotted fever: clinical, laboratory and epidemiological features of 199 cases. Am J Trop Med Hyg 35: 845-850.
- de Sousa R, Nobrega SD, Bacellar F, Torgal J (2003) Mediterranean spotted fever in Portugal: risk factors for fatal outcome in 105 hospitalized patients. Ann N Y Acad Sci 990: 285-294.
- Jayaseelan E, Rajendran SC, Shariff S, Fishbein D, Keystone JS (1991) Cutaneous eruptions in Indian tick typhus. Int J Dermatol 30: 790-794.
- Drancourt M, Beati L, Tarasevich IV, Raoult D (1992) Astrakhan fever rickettsia is identical to Israeli tick typhus rickettsia, a genotype of the Rickettsia conorii complex. J Infect Dis 165: 1167-1168.
- Tarasevich IV, Makarova V, Fetisova NF, Stepanov A, Mistkarova E, Balayeva NM, Raoult D (1991) Astrakhan fever: a new spotted fever group rickettsiosis. Lancet 337: 172-173.
- Tarasevich IV, Makarova VA, Fetisova NF, Stepanov AV, Miskarova ED, Raoult D (1991) Studies of a "new" rickettsiosis, "Astrakhan" spotted fever. Eur J Epidemiol 7: 294-298.
- Fournier PE, Durand JP, Rolain JM, Camicas JL, Tolou H, Raoult D (2003) Detection of Astrakhan fever rickettsia from ticks in Kosovo. Ann N Y Acad Sci 990: 158-161.
- Fournier PE, Xeridat B, Raoult D (2003) Isolation of a rickettsia from a patient in Chad which is related to Astrakhan fever rickettsia. Ann N Y Acad Sci 990: 152-157.
- Gross EM, Yagupsky P (1987) Israeli rickettsial spotted fever in children. A review of 54 cases. Acta Trop 44: 91-96.
4. Réservoir et transmission de R. conorii subsp. conorii
La fièvre boutonneuse méditerranéenne est une zoonose transmise à l'homme par piqûre de la tique brune du chien, Rhipicephalus sanguineus, qui en est également le réservoir. En effet, chez la tique, la rickettsie est transmise de génération à génération par voie trans-ovarienne. La fièvre boutonneuse méditerranéenne est une maladie urbaine et péri-urbaine endémique dans le pourtour méditerranéen et en Afrique. En France, elle est endémique dans le sud-est du pays où son incidence est d'environ 48/100.000 habitants [ 15 ]. Tous les âges sont atteints. Entre 1996 et 2004, la fièvre boutonneuse méditerranéenne a représenté 56% des cas de rickettsioses diagnostiqués par l'Unité des Rickettsies en France. La fièvre boutonneuse méditerranéenne est une maladie saisonnière, estivale, pouvant survenir de mai à octobre (98.5% des cas), avec un pic de juillet à septembre [ 1 ], ce qui correspond à la période d'activité des formes immatures des tiques, qui sont petites et dont la piqûre indolore passe souvent inaperçue.
Références
- Raoult D, Weiller PJ, Chagnon A, Chaudet H, Gallais H, Casanova P (1986) Mediterranean spotted fever: clinical, laboratory and epidemiological features of 199 cases. Am J Trop Med Hyg 35: 845-850.
- Raoult D, Tissot-Dupont H, Caraco P, Brouqui P, Drancourt M, Charrel C (1992) Mediterranean spotted fever in Marseille : descriptive epidemiology and the influence climatic factors. Eur J Epidemiol 8: 192-197.
Rhipicephalus sanguineus, la tique brune du chien, vecteur et réservoir de R. conorii subsp. conorii.
5. Signes cliniques de la fièvre boutonneuse méditerranéenne
Après une incubation muette d'environ 6 jours, le début est volontiers brutal et associe une fièvre (100%) supérieure à 39°C (80%), des frissons, des myalgies et des céphalées [ 1 ]. Le diagnostic peut alors être orienté par la découverte d'une escarre d'inoculation unique au site de piqûre, la "tache noire" (70 à 75% des cas). Typiquement c'est une lésion croûteuse noirâtre, indolente, de 0,5 à 2 cm de diamètre, cernée d'un halo érythémateux. Il faut la rechercher attentivement, sur les membres inférieurs et dans les plis (pli de l'aine, creux axillaire) surtout. Rarement, la contamination est oculaire et se manifeste par une conjonctivite unilatérale. A la phase d'état, 4 jours en moyenne après le début, apparaît une éruption maculo-papuleuse (97%) qui se généralise en 1 à 3 jours et s'étend aux paumes des mains et à la plante des pieds mais épargne la face. Une asthénie et des algies diffuses sont associées. L'évolution est le plus souvent spontanément favorable en quelques jours.
Escarre d'inoculation aucours de la fièvre boutonneuse méditerranéenne
Eruption maculo-papuleuse au cours de la fièvre boutonneuse méditerranéenne
Référence
- Raoult D, Weiller PJ, Chagnon A, Chaudet H, Gallais H, Casanova P (1986) Mediterranean spotted fever: clinical, laboratory and epidemiological features of 199 cases. Am J Trop Med Hyg 35: 845-850.
6. Complications de la fièvre boutonneuse méditerranéenne
Une forme sévère, la fièvre boutonneuse méditerranéenne maligne, peut survenir dans 6 à 7% des cas. Certains facteurs de risque favorisent la survenue de cette forme : âge > 60 ans, diabète, alcoolisme, tabagisme, immunodépression, déficit en G6PD. La fièvre boutonneuse méditerranéenne maligne se présente le plus souvent comme une éruption purpurique fébrile, le plus souvent associée à d'autres manifestations comme ictère et hépatomégalie, infiltration pulmonaire, coagulation intravasculaire disséminée, et anomalies neurologiques (troubles de la conscience pouvant aller jusqu'au coma, convulsions, déficit moteur). L'évolution est mortelle dans 1/3 des cas (soit ~2% des cas de fièvre boutonneuse méditerranéenne) [ 1,2 ]. Une antibiothérapie administrée précocement prévient cette évolution.
Références
- Raoult D, Zuchelli P, Weiller PJ, Charrel C, San Marco JL, Gallais H, Casanova P (1986) Incidence, clinical observations and risk factors in the severe form of Mediterranean spotted fever among patients admitted to hospital in Marseille 1983-1984. J Infect 12: 111-116.
- de Sousa R, Nobrega SD, Bacellar F, Torgal J (2003) Mediterranean spotted fever in Portugal: risk factors for fatal outcome in 105 hospitalized patients. Ann N Y Acad Sci 990: 285-294.
7. Diagnostic de la fièvre boutonneuse méditerranéenne
Le diagnostic de la fièvre boutonneuse est essentiellement clinique et repose sur un faisceau d'arguments épidémio- cliniques. Toute fièvre éruptive estivale avec escarre après séjour en zone d'endémie doit être considérée et traitée comme une fièvre boutonneuse méditerranéenne jusqu'à preuve du contraire. Le diagnostic présomptif peut être confirmé par des examens paracliniques. La biopsie d'escarre d'inoculation faite avant antibiothérapie est le meilleur échantillon clinique, permettant la détection moléculaire de la rickettsie mais également parfois sa culture. Les seuls résultats sérologiques ne permettent pas d'identifier l'espèce en cause [ 1 ]. Il existe un score diagnostique pour aider au diagnostic de la fièvre boutonneuse méditerranéenne [ 2 ].
Un diagnostic de fièvre boutonneuse méditerranéenne peut être considéré comme certain si :
- R. conorii subsp. conorii est isolée en culture dans un échantillon clinique
- R. conorii subsp. conorii est détectée par PCR dans un échantillon clinique et le patient présente une symptomatologie clinique compatible avec une fièvre boutonneuse méditerranéenne et/ou une sérologie positive contre une rickettsie du groupe boutonneux
- Le patient présente une symptomatologie clinique compatible avec une fièvre boutonneuse méditerranéenne et une réaction sérologique spécifique contre R. conorii subsp. conorii.
Références
- Raoult D, Tissot-Dupont H, Caraco P, Brouqui P, Drancourt M, Charrel C (1992) Mediterranean spotted fever in Marseille : descriptive epidemiology and the influence climatic factors. Eur J Epidemiol 8: 192-197.
- Rolain JM, Shpynov S, Raoult D (2003) Spotted-fever-group rickettsioses in north Asia. Lancet 362: 1939.
Score permettant le diagnostic de la fièvre boutonneuse
méditerranéenne. Le diagnostic est vraisemblable quand le score dépasse 25.
| Critères |
Points |
| Critères épidémiologiques |
|
| Vie ou voyage en zone d'endémie |
2 |
| Début des symptômes entre mai et septembre |
2 |
| Contact avec des tiques de chien |
2 |
| Critères cliniques |
|
| Fièvre > 39°C |
5 |
| Escarre d'inoculation |
5 |
| Eruption maculo-papuleuse ou purpurique |
5 |
| Deux des trois critères cliniques |
3 |
| Les trois critères cliniques |
5 |
| Critères biologiques aspécifiques |
|
| Thrombopénie < 150 G/L |
1 |
| TGO et/ou TGP > 50 UI/L* |
1 |
| Critères bactériologiques |
| Isolement de Rickettsia conorii dans des échantillons cliniques |
25 |
| Détection de Rickettsia conorii dans une biopsie cutanée par immunofluorescence |
25 |
| Critères sérologiques |
| Sérum unique avec Ig totales > 1 : 128 |
5 |
| Sérum unique avec IgG > 1 : 128 et IgM > 1 : 64 |
10 |
| Augmentation de 2 dilutions des titres d'Ig entre deux sérums distincts de deux semaines |
20 |
* TGO: transaminase glutamique oxalo-acétique sérique; TGP: transaminase glutamique pyruvique sérique
8. Eléments de diagnostic aspécifique
La fièvre boutonneuse méditerranéenne s'accompagne fréquemment de thrombopénie et d'une élévation modérée des transaminases sériques [ 1 ].
| Anomalie biologique |
Fréquence (%) |
| Anémie |
12% |
| Hyperleucocytose à polynucléaires |
11 - 28% |
| Leucopénie |
12 - 20% |
| Thrombopénie |
35% |
| Hyponatrémie |
25% |
| Elévation des TGO |
39% |
| Elévation des PAL |
75% |
| Hyperazotémie |
6% |
Au cours de la fièvre boutonneuse méditerranéenne maligne, hyperleucocytose à polynucléaires, thrombopénie < 100 G/L, baisse du TP, cytolyse hépatique et musculaire, hyponatrémie, hypokaliémie, et insuffisance rénale sont fréquentes.
Référence
- Drancourt M, Raoult D, Harle JR, Chaudet H, Janbon F, Charrel C, Gallais H (1990) Biological variations in 412 patients with Mediterranean spotted fever. Ann N Y Acad Sci 590: 39-50
9. Diagnostic biologique direct
L'échantillon clinique le meilleur pour le diagnostic de la fièvre boutonneuse méditerranéenne est la biopsie cutanée de l'escarre d'inoculation, de préférence avant antibiothérapie. L'amplification génique par PCR, également possible à partir de sang EDTA et de la tique prélevée sur le patient, cible différents gènes (citrate synthase, ompA, ompB, «gene D») [ 1-5 ] et permet de détecter et identifier avec certitude l'agent causal. Pour chaque réaction, de l'ADN de R. montanensis (espèce absente en Europe et de pathogénicité non démontrée), est utilisé comme témoin positif. De plus, un témoin négatif est inclus pour 6 échantillons testés.
La culture de R. conorii subsp. conorii est réservée aux laboratoires équipés d'un laboratoire de niveau de sécurité biologique 3. Elle est réalisée sur tapis cellulaire [ 6 ]. Elle peut être obtenue également à partir de sang hépariné ou de la tique trouvée sur le patient. A ce jour, 39 isolats de R. conorii subsp. conorii ont été obtenus à l'Unité des Rickettsies. L'étude en immunohistochimie de la biopsie d'escarre, utilisant des anticorps poly-ou monoclonaux, permet de montrer la bactérie directement au sein des tissus.
Références
- Roux V, Rydkina E, Eremeeva M, Raoult D (1997) Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int J Syst Bact 47: 252-261.
- Roux V, Raoult D (1995) Phylogenetic analysis of the genus Rickettsia by 16S rDNA sequencing. Res Microbiol 146: 385-396.
- Fournier PE, Roux V, Raoult D (1998) Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int J Syst Bacteriol 48: 839-849.
- Roux V, Raoult D (2000) Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol 50: 1449-1455.
- Sekeyova Z, Roux V, Raoult D (2001) Phylogeny of Rickettsia spp. inferred by comparing sequences of 'gene D', which encodes an intracytoplasmic protein. Int J Syst Evol Microbiol 51: 1353-1360.
- Marrero M, Raoult D (1989) Centrifugation-shell vial technique for rapid detection of Mediterranean spotted fever rickettsia in blood culture. Am J Trop Med Hyg 40: 197-199.
Culture de R. conorii subsp. conorii en cellules endothéliales
Mise en évidence de R. conorii subsp. conorii par immunohistochimie dans une biopsie cutanée
Amorces de PCR utilisées pour la détection des Rickettsia
| Gène |
Nom de l'amorce |
Séquence (5'-3') |
Longueur du fragment (nt) |
Ref |
|
| 16S rRNA |
fD1 |
AGAGTTTGATCCTGGCTCAG |
1450 |
[ 1 ] |
|
rp2 |
ACGGCTACCTTGTTACGACTT |
|
| Citrate synthase (gltA) |
Rp877 |
GGGGACCTGCTCACGGCGG |
381 |
[ 2 ] |
|
Rp1258 |
ATTGCAAAAAGTACAGTGAACA |
|
|
| rOmpA (ompA) |
190-70 |
ATGGCGAATATTTCTCCAAAA |
590 |
[ 3 ] |
|
190-701 |
GTTCCGTTAATGGCAGCATCT |
|
|
| rOmpB (ompB) |
120-M59 |
CCGCAGGGTTGGTAACTGC |
730 |
[ 4 ] |
|
120-807 |
CCTTTTAGATTACCGCCTAA |
|
| PS120 (sca4) |
D1f |
ATGAGTAAAGACGGTAACCT |
887 |
[ 5 ] |
|
D928r |
AAGCTATTGCGTCATCTCCG |
Références
- Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal amplification for phylogenetic study. J Bacteriol 173: 697-703.
- Roux V, Rydkina E, Eremeeva M, Raoult D (1997) Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int J Syst Bact 47: 252-261.
- Fournier PE, Roux V, Raoult D (1998) Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int J Syst Bacteriol 48: 839-849.
- Roux V, Raoult D (2000) Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol 50: 1449-1455.
- Sekeyova Z, Roux V, Raoult D (2001) Phylogeny of Rickettsia spp. inferred by comparing sequences of 'gene D', which encodes an intracytoplasmic protein. Int J Syst Evol Microbiol 51: 1353-1360.
10. PCR «suicide»
Une technique d'amplification moléculaire par PCR avec ré-amplification ciblant des fragments de séquence jamais amplifiés auparavant dans le laboratoire, utilisant des amorces à usage unique, sans témoin positif mais incluant un témoin négatif tous les 6 échantillons testés, a prouvé son utilité pour le diagnostic de la fièvre boutonneuse méditerranéenne. Cette technique nommée PCR "suicide" peut être appliquée aux biopsies cutanées, au sang EDTA, aux tiques, ainsi qu'au sérum [ 1 ].
Référence
- Fournier PE, Raoult D (2004) Suicide PCR on skin biopsy specimens for diagnosis of rickettsioses. J Clin Microbiol 42: 3428-3434.
11. Diagnostic biologique indirect
Le diagnostic indirect repose sur la sérologie. La technique de référence est l'immunofluorescence indirecte. Le sérum de chaque patient est testé systématiquement contre toutes les espèces de rickettsies pathogènes endémiques dans la zone géographique où il a contracté la maladie. Au cours de la fièvre boutonneuse méditerranéenne, les IgM apparaissent en moyenne au 16ème jour après le début des symptômes et les IgG au 22ème jour. En conséquence, il faut demander un second sérum 2 semaines après le premier pour mettre en évidence les anticorps [ 1,2 ]. La présence d'un titre d'IgM > 1:64 et/ou une multiplication par 4 des anticorps entre les 2 sérums affirment une infection récente. Cependant, en raison des réactions croisées entre les différentes espèces du genre Rickettsia, il est difficile d'identifier avec certitude le rôle de R. conorii subsp conorii.
Une réaction sérologique peut être considérée comme spécifique de R. conorii subsp. conorii si :
- le titre cumulé d'IgG +IgM contre R. conorii subsp. conorii est supérieur de 2 dilutions par rapport aux autres espèces ;
- le Western blot montre la présence d'anticorps dirigés contre les protéines membranaires de R. conorii subsp. conorii seulement [ 28 ] ;
- après adsorption croisée permettant d'éliminer les anticorps non spécifiques, il ne reste que des anticorps dirigés contre R. conorii subsp. conorii.
Le principe de l'adsoption croisée est le suivant : pour les rickettsioses, on utilise en général deux antigènes, parfois plus si nécessaire. L'un des 2 antigènes (A) correspondent à l'étiologie suspectée et l'autre (B) à la seconde étiologie la plus vraisemblable dans la zone géographique concernée compte tenu du tableau clinique. L'adsorption croisée doit être réservée aux sérums ayant des titres d'anticorps > 1 :64. L'absorption croisée consiste à tester 3 échantillons du sérum avant manipulation, puis après avoir fait réagir le sérum avec l'antigène A, ou l'antigène B. Le sérum adsorbé est ensuite testé en immunofluorescence indirecte et Western Blot contre les antigènes A et B. Le sérum non absorbé montre des anticorps contre A et B. Le sérum absorbé ne doit plus présenter de réaction contre l'antigène avec lequel il a été absorbé. En revanche, si l'adsorption avec l'un des antigènes enlève à la fois les anticorps contre les antigènes homologues et hétérologues (par exemple après absorption par A, il ne reste d'anticorps ni contre A ni contre B, alors que l'absorption par B laisse des anticorps contre A) on peut affirmer avec certitude qu'il existe une réaction spécifique contre l'antigène A.
Référence
- Beati L, Teysseire N, Raoult D (1992) Kinetics of specific antibodies in Mediterranean Spotted Fever determined by western-blotting and microimmunofluorescence. Acta Virol 36: 62-66.
- Fournier PE, Jensenius M, Laferl H, Vene S, Raoult D (2002) Kinetics of antibody responses in Rickettsia africae and Rickettsia conorii infections. Clin Diagn Lab Immunol 9: 324-328.
- Teysseire N, Raoult D (1992) Comparison of Western immunoblotting and microimmunofluoresence for diagnosis of Mediterranean spotted fever. J Clin Microbiol 30: 455-460.
Anticorps dirigés contre R. conorii subsp. conorii mis en évidence en immunofluorescence indirecte
12. Traitement de la fièvre boutonneuse méditerranéenne
Le traitement de la fièvre boutonneuse repose sur les tétracyclines, aussi bien chez l'adulte que chez l'enfant [ 1 ]. En effet, il a été démontré que l'administration de doxycycline de courte durée ne se complique pas d'une coloration des dents [ 2 ]. La doxycycline peut être administrée à la dose de 200 mg par jour chez l'adulte. Chez la femme enceinte, la doxycycline ne peut être utilisée. Dans ce cas, la josamycine à la dose de 3 g par jour peut être utilisée [ 2 ]. En règle générale, l'apyrexie est obtenue en 48 heures. La persistance de la fièvre au-delà de ce délai doit faire rechercher une autre étiologie ou une complication. Il n'est pas utile de poursuivre le traitement au-delà de 48 heures après obtention de l'apyrexie. Il n'existe pas de vaccin contre la fièvre boutonneuse méditerranéenne.
Les formes malignes de la fièvre boutonneuse méditerranéenne sont prises en charge en service de réanimation. L'antibiothérapie repose sur l'utilisation de doxycycline intraveineuse.
Référence
- Raoult D (1991) Antibiotic treatment of Rickettsiosis, recent advances and current concepts. Eur J Epidemiol 7: 276-281.
- Lochary ME, Lockhart PB, Williams WT, Jr. (1998) Doxycycline and staining of permanent teeth. Pediatr Infect Dis J 17: 429-431.
- Cohen J, Lasri Y, Landau Z (1999) Mediterranean spotted fever in pregnancy. Scand J Infect Dis 31: 202-203.
13. Etat de la recherche sur le sujet
La recherche porte actuellement sur :
- L'expression des gènes de R. conorii dans différents environnements (culture cellulaire, tique, patient) et l'analyse de son protéome
- L'identification du ligand bactérien reconnu par les cellules - hôte
- La clarification de la classification taxonomique des bactéries du genre Rickettsia.
14. Correspondants au sein de l'IFR 48
15. Comment envoyer les prélèvements au laboratoire
- Biopsie d'escarre
- si congelée à -80°C après prélèvement, envoyer en carboglace pour culture
- si non congelée à -80°C après prélèvement, envoyer à température ambiante pour PCR
- si formolée ou paraffinée, envoyer à température ambiante pour immunohistochimie
- Tique prélevée sur le patient
- si vivante, envoyer à température ambiante dans un pot à ECBU (dont le couvercle est percé de quelques trous) pour culture
- si morte, envoyer à température ambiante pour PCR
- Sang hépariné (bouchon vert): conserver à -80°C puis envoyer en carboglace pour culture
- Sang EDTA (bouchon violet): conserver à +4°C puis envoyer à température ambiante pour PCR
- Sérum : conserver à +4°C puis envoyer à température ambiante. Prélever deux échantillons à 10 jours d'intervalle
Adresser les prélèvements à :
Unité des Rickettsies
Faculté de Médecine
27 Bd Jean Moulin
13385 Marseille cedex 5
France
15.1. Consultations au sein de l'IFR 48
15.2. fiche de recueil des renseignements cliniques fievre boutonneuse mediterraneenne
Telechargeable au format PDF ici
16. Liste des publications de l'IFR 48 sur le sujet
- Anstey NM, Tissot-Dupont H, Hahn CG, Mwaikambo ED, McDonald MI, Raoult D, Sexton DJ (1997) Seroepidemiology of Rickettsia typhi, spotted fever group rickettsiae, and Coxiella burnetii infection in pregnant women from urban tanzania. Am J Trop Med Hyg 57: 187-189.
- Babalis T, Tissot-Dupont H, Tselentis Y, Chatzichristodoulou C, Raoult D (1993) Rickettsia conorii in Greece : comparison of a microimmunofluorescence assay and western blotting for seroepidemiology. Am J Trop Med Hyg 48: 784-792.
- Bacellar F (1999) Ticks and spotted fever rickettsiae in Portugal. In: Raoult D, Brouqui P, editors. Rickettsiae and rickettsial diseases at the turn of the third millenium. Paris: Elsevier. pp. 423-427.
- Beati L, Finidori JP, Gilot B, Raoult D (1992) Comparison of serologic typing, sodium dodecyl sulfate- polyacrylamide gel electrophoresis protein analysis, and genetic restriction fragment length polymorphism analysis for identification of rickettsiae : characterization of two new rickettsial strains. J Clin Microbiol 30: 1922-1930.
- Beati L, Kelly PJ, Mason PR, Raoult D (1994) Species-specific BALB/c mouse antibodies to rickettsiae studied by western blotting. FEMS Microbiol Lett 119: 339-344.
- Beati L, Roux V, Ortuno A, Castella J, Segura Porta F, Raoult D (1996) Phenotypic and genotypic characterization of spotted fever group rickettsiae isolated from catalan Rhipicephalus sanguineus ticks. J Clin Microbiol 34: 2688-2694.
- Beati L, Kelly PJ, Matthewman LA, Mason P, Raoult D (1995) Prevalence of Rickettsia-like organisms and spotted fever group Rickettsiae in ticks (Acari : Ixodidae) from Zimbabwe. J Med Entomol 32: 787-792.
- Beati L, Raoult D (1996) Spotted fever group rickettsiae. In: Kazar J, Toman R, editors. Rickettsiae and rickettsial diseases. Bratislava: Veda. pp. 134-178.
- Beati L, Raoult D (1998) Mediterranean spotted fever and other spotted fever group rickettsiae. In: Palmer SR, Soulsby L, Simpson DIH, editors. Zoonoses. Biology, clinical practice, and public health control. New York: Oxford university press. pp. 217-240.
- Beati L, Teysseire N, Raoult D (1992) Kinetics of specific antibodies in Mediterranean Spotted Fever determined by western-blotting and microimmunofluorescence. Acta Virol 36: 62-66.
- Beati L, Kelly PJ, Mason PR, Raoult D (1999) Experimental infections of vervet monkeys (Cercopithecus pygerythrus) with three spotted fever group rickettsiae. South African Journal of Sciences 95: 448-449.
- Bourgeade A, Jean-Pastor MJ, Raoult D (1979) [ Mediterranean boutonneuse fever (apropos of 40 recent cases in Marseille) ]. Bull Soc Pathol Exot Filiales 72: 308-314.
- Brouqui P, Raoult D, Vidor E (1989) Lack of co-transmission of Rickettsia conorii and Ehrlichia canis in human beings in the south of France. Eur J Epidemiol 5: 110-112.
- Brouqui P, Delmont J, Raoult D, Bourgeade A (1992) Current status of knowledge on the epidemiology of rickettsiosis in Africa. Bull Soc Pathol Exot Filial 85: 359-364.
- Brouqui P, Rousseau MC, Drancourt M, Raoult D (1993) Traitement des rickettsioses éruptives. Bull Soc Pathol Exot Filial 86: 336-341.
- Brouqui P, Raoult D (1996) Clinical aspects of human SFG rickettsiae infections in the era of molecular biology : an update. In: Kazar J, Toman R, editors. Rickettsiae and rickettsial diseases. Bratislava: Veda. pp. 195-210.
- Cardenosa N, Roux V, Font B, Sanfeliu I, Raoult D, Segura F (2000) Short report: isolation and identification of two spotted fever group rickettsial strains from patients in Catalonia, Spain. Am J Trop Med Hyg 62: 142-144.
- Cardenosa N, Segura F, Raoult D (2003) Serosurvey among Mediterranean spotted fever patients of a new spotted fever group rickettsial strain (Bar29). Eur J Epidemiol 18: 351-356.
- De La Fuente L, Anda P, Rodriguez I, Hechemy KE, Raoult D, Casal J (1989) Evaluation of a latex agglutination test for Rickettsia conorii antibodies in seropositive patients. J Med Microbiol 28: 69-72.
- De Micco C, Raoult D, Benderitter T, Gallais H, Toga M (1987) Immune complex vasculitis associated with Mediterranean spotted fever. J Infection 14: 163-165.
- De Micco C, Raoult D, Toga M (1986) Diagnosis of Mediterranean spotted fever by using an immunofluorescence technique. J Infect Dis 153: 136-138.
- Dignat-George F, Teysseire N, Mutin M, Bardin N, Lesaule G, Raoult D, Sampol J (1997) Rickettsia conorii infection enhances vascular cell adhesion molecule-1- and intercellular adhesion molecule-1-dependent mononuclear cell adherence to endothelial cells. J Infect Dis 175: 1142-1152.
- Drancourt M, Beati L, Tarasevich IV, Raoult D (1992) Astrakhan fever rickettsia is identical to Israeli tick typhus rickettsia, a genotype of the Rickettsia conorii complex. J Infect Dis 165: 1167-1168.
- Drancourt M, Georges F, Brouqui P, Sampol J, Raoult D (1992) Diagnosis of Mediterranean spotted fever by indirect immunofluoresence of Rickettsia conorii in circulating endothelial cells isolated with monoclonal antibody-coated immmunomagnetic beads. J Infect Dis 166: 660-663.
- Drancourt M, Raoult D (1994) Taxonomic position of the rickettsiae : Current knowledge. FEMS Microbiol Rev 13: 13-24.
- Drancourt M, Raoult D (1993) Antimicrobial therapy of rickettsial spotted fever. In: Raoult D, editors. Antimicrobial agents and intracellular pathogens. London: Boca Raton. pp. 139-153.
- Drancourt M, Raoult D (1989) In vitro susceptibilities of Rickettsia rickettsii and Rickettsia conorii to roxithromycin and pristinamycin. Antimicrob Agents Chemother 33: 2146-2148.
- Drancourt M, Raoult D, Harle JR, Chaudet H, Janbon F, Charrel C, Gallais H (1990) Biological variations in 412 patients with Mediterranean spotted fever. Ann N Y Acad Sci 590: 39-50.
- Drancourt M, Alessi MC, Levy PY, Juhan-Vague I, Raoult D (1990) Secretion of tissue-type plasminogen activator and plasminogen activator inhibitor by Rickettsia conorii- and Rickettsia rickettsii-infected cultured endothelial cells. Infect Immun 58: 2459-2463.
- Drancourt M, Teysseire N, Raoult D (1991) Diagnostic de la fièvre boutonneuse méditerranéenne. Revue Française des Laboratoires 228: 47-50.
- Drancourt M, Kelly PJ, Regnery RL, Raoult D (1992) Identification of spotted fever group rickettsiae using polymerase chain reaction and restriction-endonuclease length polymorphism analysis. Acta Virol 36: 1-6.
- Drancourt M, Raoult D (1994) Taxonomic position of the rickettsiae: current knowledge. FEMS Microbiol Rev 13: 13-24.
- Dujella J, Morovic M, Dzelalija B, Gveric M, Novakovic S (1991) Histopathology and immunopathology of skin biopsy specimens in Mediterranean Spotted Fever. In: Kazar J, Raoult D, editors. Rickettsiae and Rickettsial diseases. Bratislava: House of the slovak academy of the slovak academy of sciences. pp. 272-280.
- Dzelalija B, Morovic M, Novakovic S (1991) Rickettsial antibody in north dalmatia : antibodies to R. conorii, R. akari, R. typhi, R. slovaca and C. burnetii among urban and rural population. In: Kazar J,
- El Dessouky AG, Manor EA, Lange JV, Azad F (1991) Detection of spotted fever group rickettsiae in ticks from the North Sinaï, Egypt. In: Kazar J, Raoult D, editors. Rickettsiae and rickettsial diseases. Bratislava: Publishing House of the Slovak Academy of Sciences. pp. 383-388.
- Eremeeva ME, Yu X, Raoult D (1994) Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment length polymorphism of PCR- amplified DNA. J Clin Microbiol 32: 803-810.
- Eremeeva ME, Balayeva NM, Ignatovich VF, Raoult D (1995) Serologic response to rickettsial antigens in patients with Astrakhan fever. Eur J Epidemiol 11: 383-387.
- Eremeeva ME, Balayeva NM, Ignatovich VF, Raoult D (1993) Proteinic and genomic identification of spotted fever group rickettsiae isolated in the former USSR. J Clin Microbiol 31: 2625-2633.
- Eremeeva ME, Balayeva NM, Raoult D (1994) Purification of rickettsial cultures contamined by mycoplasmas. Acta Virol 38: 231-233.
- Eremeeva ME, Beati L, Makarova VA, Fetisova NF, Tarasevich IV, Balayeva NM, Raoult D (1994) Astrakhan fever rickettsiae: antigenic and genotypic of isolates obtained from human and Rhipicephalus pumilio ticks. Am J Trop Med Hyg 51: 697-706.
- Espejo-Arenas E, Raoult D (1989) First isolates of Rickettsia conorii in Spain using a centrifugation-shell vial assay. J Infect Dis 159: 1158-1159.
- Fan MY, Zhang JZ, Chen M, Yu XJ (1999) Spotted fever group rickettsioses in China. In: Raoult D, Brouqui P, editors. Rickettsiae and rickettsial diseases at the turn of the third millenium. Paris: Elsevier. pp. 247-257.
- Fenollar F, Raoult D (1999) Diagnosis of rickettsial diseases using samples dried on blotting paper. Clin Diag Lab Immunol 6: 483-488.
- Fournier PE, Roux V, Raoult D (1998) Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. Int J Syst Bacteriol 48: 839-849.
- Fournier PE, Jensenius M, Laferl H, Vene S, Raoult D (2002) Kinetics of antibody responses in Rickettsia africae and Rickettsia conorii infections. Clin Diagn Lab Immunol 9: 324-328.
- Fournier PE, Durand JP, Rolain JM, Camicas JL, Tolou H, Raoult D (2003) Detection of Astrakhan fever rickettsia from ticks in Kosovo. Ann N Y Acad Sci 990: 158-161.
- Fournier PE, Xeridat B, Raoult D (2003) Isolation of a rickettsia from a patient in Chad which is related to Astrakhan fever rickettsia. Ann N Y Acad Sci 990: 152-157.
- Fournier PE, Dumler JS, Greub G, Zhang J, Yimin W, Raoult D (2003) Gene sequence-based criteria for the identification of new Rickettsia isolates and description of Rickettsia heilongjiangensis sp. nov. J Clin Microbiol 41: 5456-5465.
- Fournier PE, Zhu Y, Ogata H, Raoult D (2004) Use of highly variable intergenic spacer sequences for multispacer typing of Rickettsia conorii strains. J Clin Microbiol 42: 5757-5766.
- George F, Brouqui P, Boffa MC, Mutin M, Drancourt M, Brisson C, Raoult D, Sampol J (1993) Demonstration of Rickettsia conorii-induced endothelial injury in vivo by measuring circulating endothelial cells, thrombomodulin and Von Willebrand factor in patients with mediterranean spotted fever. Blood 82: 2109-2116.
- Gilot B, Laforge ML, Pichot J, Raoult D (1990) Relationships between the Rhipicephalus sanguineus complex ecology and Mediterranean spotted fever epidemiology in France. Eur J Epidemiol 6: 357-362.
- Hechemy KE, Raoult D, Fox J, Han Y, Elliott LB, Rawlings J (1989) Cross-reaction of immune sera from patients with rickettsial diseases. J Med Microbiol 29: 199-202.
- Hechemy KE, Raoult D, Eisemann C, Han YS, Fox JA (1986) Detection of antibodies to Rickettsia conorii with a latex agglutination test in patients with Mediterranean spotted fever. J Infect Dis 153: 132-135.
- Houhamdi L, Fournier PE, Fang R, Lepidi H, Raoult D (2002) An experimental model of human body louse infection with Rickettsia prowazekii. J Infect Dis 186: 1639-1646.
- Houvenaeghel M, Ottomani A, Raoult D, Rouzaud M, Manelli JC, Bimar J (1984) [ A severe form of Mediterranean boutonneuse fever ]. Ann Fr Anesth Réanim 3: 134-136.
- Janbon F, Raoult D, Reynes J, Bertrand A (1989) Concomitant human infection due to Rickettsia conorii and Coxiella burnetii [ letter ]. J Infect Dis 160: 354-355.
- Kaplanski G, Teysseire N, Farnarier C, Kaplanski S, Dinarello CA, Bongrand P, Raoult D (1993) Endothelial infection by Rickettsia conorii induces expression of membrane IL-1a and secretion of the pro-inflammatory cytokines IL-6 and IL-8. J Clin Invest submitted:
- Kelly PJ, Mason PR, Raoult D (1998) Spotted fever group rickettsiae in southern Africa - a review and current concepts. Cent Afr Med J 44: 111-118.
- La Scola B, Raoult D (1996) Diagnosis of Mediterranean spotted fever by cultivation of Rickettsia conorii from blood and skin samples using the centrifugation-shell vial technique and by detection of R. conorii in circulating endothelial cells: a 6 year follow-up. J Clin Microbiol 34: 2722-2727.
- La Scola B, Raoult D (1997) Laboratory diagnosis of rickettsioses: current approaches to the diagnosis of old and new rickettsial diseases. J Clin Microbiol 35: 2715-2727.
- Marrero M, Raoult D (1989) Centrifugation-shell vial technique for rapid detection of Mediterranean spotted fever rickettsia in blood culture. Am J Trop Med Hyg 40: 197-199.
- Niang M, Parola P, Tissot-Dupont H, Baidi L, Brouqui P, Raoult D (1998) Prevalence of antibodies to Rickettsia conorii, Rickettsia africae, Rickettsia typhi and Coxiella burnetii in Mauritania. Eur J Epidemiol 14: 817-818.
- Novakovic S, Morovic M, Dzelalija B (1991) A comparison of serologic methods for diagnosis of Mediterranean Spotted Fever. In: Kazar J, Raoult D, editors. Rickettsiae and Rickettsial diseases. Bratislava: House of the slovak academy of the slovak academy of sciences. pp. 614-622.
- Ogata H, Audic S, Barbe V, Artiguenave F, Fournier PE, Raoult D, Claverie JM (2000) Selfish DNA in protein-coding genes of Rickettsia. Science 290: 347-350.
- Ogata H, Audic S, Renesto-Audiffren P, Fournier PE, Barbe V, Samson D, Roux V, Cossart P, Weissenbach J, Claverie JM, Raoult D (2001) Mechanisms of evolution in Rickettsia conorii and R. prowazekii. Science 293: 2093-2098.
- Omezzine-Letaief A, Yacoub S, Tissot-Dupont H, Le Cam C, Ghachem L, Letaief J, Raoult D (1995) Seroepidemiological survey of rickettsial infections among blood donors in central Tunisia. Trans R Soc Trop Med Hyg 89: 266-268.
- Parola P, Fenollar F, Badiaga S, Brouqui P, Raoult D (2001) First documentation of Rickettsia conorii infection (strain Indian tick typhus) in a traveller. Emerg Infect Dis 7: 909-910.
- Parola P, Inokuma H, Camicas JL, Brouqui P, Raoult D (2001) Detection and identification of spotted fever group Rickettsiae and Ehrlichiae in African ticks. Emerg Infect Dis 7: 1014-1017.
- Raoult D, Dasch GA (1989) Line blot and western blot immunoassays for diagnosis of Mediterranean spotted fever. J Clin Microbiol 27: 2073-2079.
- Raoult D, Lepeu G, de Micco P, San Marco JL, Weiller PJ, Gallais H, Casanova P (1984) Recrudescence de la fièvre boutonneuse meditarraneenne dans le sud de la France. Méditerranée Médicale 3: 102-103.
- Raoult D, De Micco C, Gallais H (1985) Laboratory diagnosis of mediterranean spotted fever by immunofluorescent demonstration of Rickettsia conorii in cutaneous lesions. J Infect Dis 150: 145-148.
- Raoult D, Roussellier P, Tamalet J (1988) In vitro evaluation of josamycin, spiramycin, and erythromycin against Rickettsia rickettsii and R. conorii. Antimicrob Agents Chemother 32: 255-256.
- Raoult D, Roussellier P, Vestris G, Galicher V, Perez R, Tamalet J (1987) Susceptibility of Rickettsia conorii and R. rickettsii to pefloxacin, in vitro and in ovo. J Antimicrob Chemother 19: 303-305.
- Raoult D, Toga B, Chaudet H, Chiche-Portiche C (1987) Rickettsial antibody in southern France: antibodies to Rickettsia conorii and Coxiella burnetii among urban, suburban and semi-rural blood donors. Trans Roy Soc Trop Med Hyg 81: 80-81.
- Raoult D, Arnoux D, Drancourt M, Ardissone JP (1987) Enzyme secretion by human endothelial cells infected with Rickettsia conorii. Acta Virol 31: 352-356.
- Raoult D, Roussellier P, Vestris G, Tamalet J (1987) In vitro antibiotic susceptibility of Rickettsia rickettsii and Rickettsia conorii: plaque assay and microplaque colorimetric assay. J Infect Dis 155: 1059-1062.
- Raoult D, Weiller PJ, Chagnon A, Chaudet H, Gallais H, Casanova P (1986) Mediterranean spotted fever: clinical, laboratory and epidemiological features of 199 cases. Am J Trop Med Hyg 35: 845-850.
- Raoult D, Roussellier P, Galicher V, Perez R, Tamalet J (1986) In vitro susceptibility of Rickettsia conorii to ciprofloxacin as determined by suppressing lethality in chicken embryos and by plaque assay. Antimicrob Agents Chemother 29: 424-425.
- Raoult D, Zuchelli P, Weiller PJ, Charrel C, San Marco JL, Gallais H, Casanova P (1986) Incidence, clinical observations and risk factors in the severe form of Mediterranean spotted fever among patients admitted to hospital in Marseille 1983-1984. J Infect 12: 111-116.
- Raoult D, De Micco C, Chaudet H, Tamalet J (1985) Serological diagnosis of Mediterranean spotted fever by the immunoperoxidase reaction [ letter ]. Eur J Clin Microbiol Infect Dis 4: 441-442.
- Raoult D, Rousseau S, Toga B, Chaudet H, Tamalet J, de Micco P (1985) Indirect fluorescent antibody test in Mediterranean spotted fever. Detection and kinetics of antibodies [ letter ]. Acta Virol 29: 516.
- Raoult D, Nicolas D, de Micco P, Gallais H, Casanova P (1985) Aspects épidémiologiques de la fièvre boutonneuse méditerranéenne en Corse du Sud. Bull Soc Pathol Exot Filial 78: 446-451.
- Raoult D, Toga B, Dunan S, Davoust B, Quilici M (1985) Mediterranean spotted fever in the South of France; serosurvey of dogs. Trop Geogr Med 37: 258-260.
- Raoult D, Hechemy KE, Chaudet H (1985) [ Serology of Mediterranean boutonneuse fever. Kinetics of antibodies detected by 3 methods: indirect immunofluorescence, indirect hemagglutination and latex agglutination ]. Pathol Biol 33: 839-841.
- Raoult D, Dasch GA (1995) Immunoblot cross-reactions among Rickettsia, Proteus spp. and Legionella spp. in patients with Mediterranean spotted fever. FEMS Immunol Med Microbiol 11: 13-18.
- Raoult D, Rousseau S, Toga B, Tamalet C, Gallais H, de Micco P, Casanova P (1984) Serology diagnosis of mediterranean boutonneuse fever. Pathol Biol 32: 791-794.
- Raoult D, De Micco C, Gallais H, Toga M (1984) Laboratory diagnosis of Mediterranean spotted fever by immunofluorescent demonstration of Rickettsia conorii in cutaneous lesions. J Infect Dis 150: 145-148.
- aoult D, Jean-Pastor MJ, Xeridat B, Garnier JM, Weiller PJ, Garcin G, Privat Y, Gallais H, Casanova P (1983) [ Mediterranean boutonneuse fever. A propos of 154 recent cases ]. Ann Dermatol Venereol 110: 909-914.
- Raoult D, Gallais H, Ottomani A, Resch JP, Tichadou D, de Micco P, Casanova P (1983) [ Malignant form of Mediterranean boutonneuse fever. 6 cases ]. Presse Med 12: 2375-2378.
- Raoult D, Gallais H, de Micco P, Casanova P (1986) Ciprofloxacin therapy for Mediterranean spotted fever. Antimicrob Agents Chemother 30: 606-607.
- Raoult D, Bres P, Drancourt M, Vestris G (1991) In vitro susceptibilities of Coxiella burnetii, Rickettsia rickettsii, and Rickettsia conorii to the fluoroquinolone Sparfloxacin. Antimicrob Agents Chemother 35: 88-91.
- Raoult D, Weiller PJ, Esterni JP, Garnier JM, Gallais H, Casanova P (1983) [ La fievre boutonneuse mediterraneenne ]. Le Concours Médical 2933-2939.
- Raoult D, De Micco C, Jancovici E, Sayag J, Boucraut J, Gallais H, Toga M (1986) Early diagnosis of mediterranean spotted fever. Value of skin biopsy with anti-Rickettsia conorii immunofluorescence. Sem Hop Paris 62: 1011-1013.
- Rolain JM, Maurin M, Vestris G, Raoult D (1998) In vitro susceptibilities of 27 rickettsiae to 13 antimicrobials. Antimicrob Agents Chemother 42: 1537-1541.
- Rolain JM, Maurin M, Bryskier A, Raoult D (2000) In vitro activities of telithromycin (HMR 3647) against Rickettsia rickettsii, Rickettsia conorii, Rickettsia africae, Rickettsia typhi,Rickettsia prowazekii, Coxiella burnetii, Bartonella henselae, Bartonella quintana, Bartonella bacilliformis, and Ehrlichia chaffeensis. Antimicrob Agents Chemother 44: 1391-1393.
- Roux V, Raoult D (1993) Genotypic identification and phylogenetic analysis of the spotted fever group Rickettsiae by pulsed-field gel electrophoresis. J Bacteriol 175: 4895-4904.
- Roux V, Drancourt M, Raoult D (1992) Determination of genome sizes of Rickettsia spp. within the spotted fever group using pulsed-field gel electrophoresis. J Bacteriol 174: 7455-7457.
- Roux V, Fournier PE, Raoult D (1996) Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol 34: 2058-2065.
- Roux V, Fournier PE, Rydkina E, Raoult D (1996) Phylogenetic study of the rickettsiae. In: Kazar J, Toman R, editors. Rickettsiae and rickettsial diseases. Bratislava: Veda. pp. 34-42.
- Roux V, Rydkina E, Eremeeva M, Raoult D (1997) Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. Int J Syst Bact 47: 252-261.
- Roux V, Raoult D (1998) [ Etude phylogénétique et identification des bactéries du genre Rickettsia ]. Med Mal Infec 28: 376-379.
- Roux V, Raoult D (1995) Phylogenetic analysis of the genus Rickettsia by 16S rDNA sequencing. Res Microbiol 146: 385-396.
- Roux V (1999) Phylogenetic analysis and taxonomic relationships among the genus Rickettsia. In: Raoult D, Brouqui P, editors. Rickettsiae and Rickettsial diseases at the turn of the third millinium. Marseille: Elsevier. pp. 52-66.
- Roux V, Raoult D (2000) Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol Microbiol 50: 1449-1455.
- Ruiz Beltran R, Herrero-Herrero JI (1990) New quinolones in the treatment of Mediterranean Spotted Fever (MSF): a comparative study with other antibiotic regimens. In: Kazar J, Raoult D, editors. Rickettsiae and Rickettsial Diseases. Bratislava: Publishing House of the Slovak Academy of Sciences. pp. 714-717.
- Sekeyova Z, Roux V, Raoult D (2001) Phylogeny of Rickettsia spp. inferred by comparing sequences of 'gene D', which encodes an intracytoplasmic protein. Int J Syst Evol Microbiol 51: 1353-1360.
- Teysseire N, Arnoux D, George F, Sampol J, Raoult D (1992) Von Willebrand factor release, thrombomodulin and tissue factor expression in Rickettsia conorii infected endothelial cells. Infect Immun 60: 4388-4393.
- Teysseire N, Raoult D (1992) Comparison of Western immunoblotting and microimmunofluoresence for diagnosis of Mediterranean spotted fever. J Clin Microbiol 30: 455-460.
- Teysseire N, Chiche-Portiche C, Raoult D (1992) Intracellular movements of Rickettsia conorii and R. typhi based on actin polymerization. Res Microbiol 143: 821-829.
- Teysseire N, Boudier JA, Raoult D (1995) Rickettsia conorii entry into vero cells. Infect Immun 63: 366-374.
- Tissot-Dupont H, Brouqui P, Faugere B, Raoult D (1995) Prevalence of antibodies to Coxiella burnetii, Rickettsia conorii, and Rickettsia typhi in seven African countries. Clin Infect Dis 21: 1126-1133.
- Tissot-Dupont H, Raoult D (1993) Epidémiologie de la fièvre boutonneuse méditerraneenne en France. Med Mal Infec 23: 485-490.
- Tringali G, Occhino C, Mansueto S, Walker DH, Raoult D (1986) Fièvre boutonneuse méditerranéenne diagnostiquée pendant la saison froide : quatre cas. Med Mal Infec 3: 183-184.
- Xu WB, Raoult D (1997) Distribution of immunogenic epitopes on the two major immunodominant proteins (rOmpA and rOmpB) of Rickettsia conorii among the other rickettsiae of the spotted fever group. Clin Diag Lab Immunol 4: 753-763.
- Zhu Y, Fournier PE, Eremeeva M, Raoult D (2005) Proposal to create subspecies of Rickettsia conorii based on multi-locus sequence typing and an emended description of Rickettsia conorii. BMC Microbiol 5: 11.