1. Généralités

Le genre Bartonella comprend actuellement 21 espèces validées. Ces espèces regroupent B. bacilliformis, les espèces anciennement classées dans les genres Rochalimaea et Grahamella et de nombreuses espèces caractérisées récemment. Sur le plan phylogénique, le genre Bartonella est classé dans le groupe alpha des Proteobacteria, proche des genres Brucella, Afipia, Agrobacterium et Rhizobium, mais plus éloigné du genre Rickettsia.

Les bactéries du genre Bartonella sont considérées comme des micro-organismes intracellulaires facultatifs. In vivo, B. bacilliformis et B. quintana peuvent être observées dans les érythrocytes de patients bactériémiques et B.henselae, B. clarridgeiae, B. koehlerae peuvent être isolées et détectées dans le sang et les globules rouges de chats bactériémiques . Ces bactéries possèdent également un tropisme pour les cellules endothéliales, qui semble corrélé à leur capacité à induire des lésions angioprolifératives (veruga peruana pour B. bacilliformis, et angiomatose bacillaire pour B. henselae et B. quintana).

2. Introduction

La maladie des griffes du chat est une infection humaine émergente due à une bactérie qui s'appelle Bartonella henselae (anciennement dénommée Rochalimea henselae) et qui se manifeste le plus souvent par une adénopathie. L'identification de B. henselae n'a été obtenue qu'en 1992 par Regnery et col. qui ont montré que la plupart des patients atteints de maladie des griffes du chat, affection décrite en 1950 par Debré et col., et pour laquelle un agent étiologique (Afipia felis) avait été proposé en 1988, possédaient des anticorps dirigés contre les antigènes de B. henselae. Le débat sur l'agent étiologique de la maladie des griffes aboutira à la démonstration de la responsabilité prédominante de B. henselae dans cette affection. Bien que B. quintana ne soit pas considéré comme agent étiologique de maladie des griffes du chat, cette bactérie a été isolée du sang de patients présentant comme seuls signes cliniques la présence d'adénopathies périphériques fébriles.

Références

  1. Regnery, R. L., Anderson, B. E., Clarridge, J. E., Rodriguez-Barradas, M. C., Jones, D. C. & Carr, J. H. (1992) J. Clin. Microbiol. 30, 265-274.
  2. Debré, R., Lamy, M., Jammet, M. L., Costil, L. & Mozziconacci, P. (1950) Soc. Med. Hôp. Paris 66, 76-79.
  3. English, C. K., Wear, D. J., Margileth, A. M., Lissner, C. R. & Walsh, G. P. (1988) J. Amer. Med. Assoc. 259, 1347.
  4. Drancourt, M., Moal, V., Brunet, P., Dussol, B., Berland, Y. & Raoult, D. (1996) J. Clin. Microbiol. 34, 1158-1160.

3. Description du microorganisme

Les bactéries du genre Bartonella sont de petits bacilles à Gram négatif, aérobies, oxydase et catalase négatives. Sur le plan phylogénique, les bactéries du genre Bartonella sont classées dans le groupe alpha des Proteobacteria, proche des genres Brucella, Afipia, Agrobacterium et Rhizobium, mais plus éloigné du genre Rickettsia. Il existe, au sein de l'espèce B. henselae, trois génotypes, B. henselae Houston, B. enselae Marseille, et B. henselae Berlin-2. L'espèce B. henselae Houston-1 a été entièrement séquencée récemment et son génome fait 1.93 Mégabases.

Figure 1 Phylogénie des bactéries du genre Bartonella à partir du gène de l'ARN 16S ribosomal

Références

  1. Birtles, R. J., Harrison, T. G., Saunders, N. A. & Molyneux, D. H. (1995) Int. J. Syst. Bact. 45, 1-8.
  2. Zeaiter,Z.; Fournier,P.E.; Raoult,D. (2002) J. Clin. Microbiol. 40, 1023-1030
  3. Alsmark,C.M.et al. (2004) P.N.A.S. 101, 9716-9721
  4. Iredell,J. et al (2003) J. Clin. Microbiol. 41, 5071-5079

4. Habitat, réservoir

B. henselae a une distribution ubiquitaire dont le principal réservoir est le chat domestique. Le rôle du chat domestique comme principal réservoir de B. henselae est suggéré à la fois par l'isolement de la bactérie dans le sang de 4 à 70% de chats asymptomatiques, et par la présence de chats dans l'entourage de la plupart des patients infectés par cette espèce. D'autres espèces de Bartonella ont été isolées à partir du sang de chats asymptomatiques notamment B. clarridgeiae, B. koehlerae. Chez le chat, les cellules cibles des bactéries sont les globules rouges et il est possible de détecter ces bactéries en position intraérythrocytaire sur un frottis sanguin après immunofluorescence indirecte à l'aide d'un anticorps monoclonal (Photo 1). Le contact avec des chats est le facteur de risque essentiel retrouvé au cours de la maladie des griffes du chat, des endocardites, et de l'angiomatose bacillaire lorsque l'espèce B. henselae est en cause. La bactériémie à B. henselae chez le chat demeure le plus souvent asymptomatique. Le contact avec des chats est le facteur de risque essentiel retrouvé au cours de la maladie des griffes du chat.

Photo 1 Présence de B. henselae dans les globules rouges de chat révélés après immunofluorescence directe à l'aide d'un anticorps monoclonal

Références

  1. Rolain,J.M. et al. (2001) J Clin Microbiol, 39:2978-2980
  2. La Scola, B., Davoust B., Boni, M., Raoult, D. (2002) Clin Microb Infect 8, 345-351.
  3. Rolain,J.M. et al. (2004) Clin Diag Lab Immun. 11:423-425
  4. Regnery, R., Martin, M. & Olson, J. (1992) Lancet 340, 557.

5. Modes de transmission, source

Au sein de la population féline, la *transmission* de B. henselae semble être assurée par Ctenocephalides felis (puce du chat). Nos études récentes au laboratoire ont pu mettre en évidence la présence très fréquente de B. henselae dans les puces de chat et également des co-infections avec d'autres espèces notamment B. clarridgeaie, B. koehlerae, B. quintana, et Rickettsia felis. L'homme se contamine principalement par griffure ou morsure de chat. Le rôle des puces de chat dans la transmission de B. henselae du chat à l'homme a été évoquée mais n'est pas établie formellement.

Références

  1. Koehler, J. E., Glaser, C. A. & Tappero, J. W. (1994) JAMA 271, 531-535.
  2. Rolain, J. M., M. Franc, B. Davoust, and D. Raoult. 2003. Molecular detection of Bartonella quintana, B. koehlerae, B. henselae, B. clarridgeiae, Rickettsia felis and Wolbachia pipientis in cat fleas, France. Emerg.Infect.Dis. 9:338-342
  3. Chomel, B. B., Kasten, R. W., Floyd-Hawkins, K., Chi, B., Yamamoto, K., Roberts-Wilson, J., Gurfield, A. N., Abbott, R. C., Pedersen, N. C. & Koehler, J. E. (1996) J. Clin. Microbiol. 34, 1952-1956.

6. Signes cliniques

6.1. La maladie des griffes du chat

La maladie des griffes du chat correspond, dans la majorité des cas, à la survenue d'une adénopathie dans le territoire de drainage d'une lésion cutanée due à une griffure de chat. Lors du diagnostic on retrouve une lésion d'inoculation au point de griffure associée à l'adénopathie dans environ 60% des cas (Photo 2).Cette adénopathie évolue spontanément vers la guérison après quelques semaines ou quelques mois, et reste insensible au traitement antibiotique. De ce fait, elle peut faire redouter une affection plus sévère en particulier la tuberculose ou un lymphome, ce qui justifie son exérèse fréquente. Chez environ 10% des patients, l'adénopathie évolue vers une suppuration locale. Les formes sévères ou systémiques peuvent compliquer la maladie des griffes du chat dans 5 à 14% des cas notamment des formes viscérales chez l'enfant avec adénopathies multiples et atteint hépatique et/ou splénique.

Photo 2 Lésion d'inoculation au point de griffure


Références

  1. Carithers, H. A. (1985) Am. J. Dis. Child. 139, 1124-1133.
  2. Margileth, A. M., Wear, D. J. & English, C. K. (1987) J. Infect. Dis. 155, 390-404.
  3. Carithers, H. A. (1978) Am. J. Dis. Child. 132, 1195-1200.

6.2. Angiomatose bacillaire

Cette affection, caractérisée par une prolifération vasculaire et des cellules endothéliales, survient principalement chez des patients immunodéprimés, le plus souvent du fait d'une infection par le VIH ou chez des patients transplantés, et exceptionnellement sur terrain immunocompétent. Les lésions peuvent intéresser la peau (angiomatose bacillaire cutanée), avec formation de pseudotumeurs angiomateuses, unique ou multiples, superficielles violacées, saignant facilement au contact, dermiques ou sous cutanées pouvant s'étendre aux tissus profonds notamment à l'os. Ces manifestations cutanées sont souvent associées à des lésions au niveau des différentes muqueuses, avec notamment possibilité de saignements d'origine digestive. L'angiomatose bacillaire peut également se manifester sous la forme d'une affection systémique, multiviscérale, intéressant notamment le foie, la rate, les poumons, le cerveau, la moelle osseuse, les ganglions.

6.3. Péliose hépatique

La péliose hépatique est une affection caractérisée par une prolifération des capillaires sinusoïdes hépatiques, conduisant à la formation de larges espaces vasculaires. La péliose hépatique a été décrite pour la première fois en 1990 chez des patients sidéens. Elle est liée à l'infection par B. henselae dans cette population. Toutefois, la péliose hépatique due à B. henselae existe également sur d'autres terrains comme en atteste sa description récente chez un patient transplanté rénal. Des lésions similaires ont été décrites dans la rate et les ganglions lymphatiques, d'où le terme proposé de péliose bacillaire. La péliose bacillaire peut être associée à des lésions d'angiomatose bacillaire, mais s'en distingue par l'absence de prolifération endothéliale.

Références

  1. Gasquet, S., M. Maurin, P. Brouqui, H. Lepidi, and D. Raoult. 1998. Bacillary angiomatosis in immunocompromised patients: a clinicopathological and microbiological study of seven cases and review of literature. AIDS 12:1793-1803.
  2. Koehler, J. E. 1995. Bartonella-associated infections in HIV-infected patients. AIDS Clin.Care 7:97-102.
  3. Koehler, J. E., P. E. Leboit, B. M. Egbert, and T. G. Berger. 1988. Cutaneous vascular lesions and disseminated cat-scratch disease in patients with the acquired immunodeficiency syndrome (AIDS) and AIDS-related complex. Ann.Intern.Med. 109:449-455.
  4. Koehler, J. E., M. A. Sanchez, C. S. Garrido, M. J. Whitfeld, F. M. Chen, T. G. Berger, M. C. Rodriguez-Barradas, P. E. Leboit, and J. W. Tappero. 1997. Molecular epidemiology of Bartonella infections in patients with bacillary angiomatosis-peliosis. N.Engl.J.Med. 337:1876-1883.
  5. Koehler, J. E., M. A. Sanchez, S. Tye, C. S. Garrido-Rowland, F. M. Chen, T. Maurer, J. L. Cooper, J. G. Olson, A. L. Reingold, W. K. Hadley, R. R. Regnery, and J. W. Tappero. 2003. Prevalence of Bartonella infection among human immunodeficiency virus-infected patients with fever. Clin.Infect.Dis. 37:559-566.
  6. Koehler, J. E. and J. W. Tappero. 1993. Bacillary angiomatosis and bacillary peliosis in patients infected with human immunodeficiency virus. Clin.Infect.Dis. 17 :612-624.
  7. Tappero, J. W., J. E. Koehler, T. G. Berger, C. J. Cockerell, T. H. Lee, M. P. Busch, D. P. Stites, J. C. Mohle-Boetani, A. L. Reingold, and P. E. Leboit. 1993. Bacillary angiomatosis and bacillary splenitis in immunocompetent adults. Ann.Intern.Med. 118:363-365

6.4. Bactériémies

Des cas de bactériémies isolées à B. henselae ont été rapportés pour la première fois en 1990, chez trois patients immunodéprimés (deux patients infectés par le VIH, et un patient ayant subi une greffe de moelle osseuse), et chez deux patients immunocompétents.

6.5. Endocardites

Les endocardites à Bartonella sp. surviennent en règle sur valves natives, et se caractérisent par des lésions valvulaires extensives nécessitant souvent le recours à la chirurgie de remplacement valvulaire. Les endocardites à B. henselae sont diagnostiquées habituellement chez des patients porteurs d'une valvulopathie, et en contact avec des chats et représentent environ 20% des cas d'endocardites à Bartonella ; 80% sont dues à B. quintana.

Références

  1. Slater, L. N., D. F. Welch, D. Hensel, and D. W. Coody. 1990. A newly recognized fastidious gram-negative pathogen as a cause of fever and bacteremia. N.Engl.J.Med. 323:1587-1593
  2. Fournier, P. E., H. Lelievre, S. J. Eykyn, J. L. Mainardi, T. J. Marrie, F. Bruneel, C. Roure, J. Nash, D. Clave, E. James, C. Benoit-Lemercier, L. Deforges, H. Tissot-Dupont, and D. Raoult. 2001. Epidemiologic and clinical characteristics of Bartonella quintana and Bartonella henselae endocarditis: a study of 48 patients. Medicine (Baltimore) 80:245-251.
  3. Raoult, D., P. E. Fournier, M. Drancourt, T. J. Marrie, J. Etienne, J. Cosserat, P. Cacoub, Y. Poinsignon, P. Leclercq, and AM. Sefton. 1996. Diagnosis of 22 new cases of Bartonella endocarditis. Ann.Intern.Med. 125:646-652.
  4. Raoult, D., P. E. Fournier, F. Vandenesch, J. L. Mainardi, S. J. Eykyn, J. Nash, E. James, C. Benoit-Lemercier, and T. J. Marrie. 2003. Outcome and treatment of bartonella endocarditis. Arch.Intern.Med. 163:226-230

7. Formes rares d'infections dues à B. henselae

Il existe des cas de méningoencéphalites isolées, des neurorétinites stellaires très spécifiques d'une infection à B. henselae (photo 3), des ostéomyélites (photo 4), et des péricardites.

Photo 3 Rétinite stellaire à B. henselae (courtoisie Dr MJ Dolan)

Photo 4 Ostéomyélite vertébrale à B. henselae

Références

  1. Levy, P. Y., P. E. Fournier, M. Carta, and D. Raoult. 2003. Pericardial effusion in a homeless man due to Bartonella quintana. J.Clin.Microbiol. 41:5291-5293.
  2. Marra, C. M. 1995. Neurologic complications of Bartonella henselae infection. Curr.Opin.Neurol. 8:164-169.
  3. Rolain, J. M., V. Chanet, H. Laurichesse, J. Beytout, and D. Raoult. 2003. Cat scratch disease with vertebral osteomyelitis and spleen abscesses. Ann.N.Y.Acad.Sci. 990:397-403.
  4. Wong, M. T.et al 1995. Neuroretinitis, aseptic meningitis, and lymphadenitis associated with Bartonella (Rochalimaea) henselae infection in immunocompetent patients and patients infected with human immunodeficiency virus type 1. Clin.Infect.Dis. 21:352-360

8. Diagnostic biologique - Approche générale

Le diagnostic de cette maladie est souvent délicat car ces bactéries sont difficiles à cultiver. L'approche diagnostique nécessite donc le plus souvent l'utilisation de plusieurs méthodes complémentaires (cf Tableau récapitulatif) en fonction du statut immunitaire du patient et de la symptomatologie. Le diagnostic non spécifique de la maladie doit comprendre une numération formule sanguine, un ionogramme avec bilan hépatique et en fonction du contexte une analyse de LCR et un examen anatomopathologique standard de biopsies. Le diagnostic spécifique repose d'une part sur le diagnostic direct (culture de sang, de biopsies de peau ou de valve; mise en évidence directe de la bactérie sur coupes histologiques par immunohistochimie à l'aide d'un anticorps monoclonal ou sur frottis sanguins (détection directe dans les globules rouges); amplification génique par PCR) et d'autre part sur le diagnostic indirect (sérologie, western blot et adsorption croisée).

9. Sérologie

La sensibilité de la sérologie varie en fonction des techniques utilisées de 50 à 88% chez les patients atteints de maladie des griffes du chat. La valeur prédictive positive est de l'ordre de 65%. Le seuil de positivité de la sérologie B. henselae (c'est à dire le titre auquel le taux d'anticorps devient significatif) reste encore à déterminer formellement, et varie en fonction de la technique utilisée. La sérologie semble actuellement particulièrement intéressante au cours de la maladie des griffes du chat et des endocardites à Bartonella spp. Nous considérons actuellement, dans notre laboratoire, un titre en IgG > 1:100 en IFI comme significatif au cours de la maladie des griffes du chat, alors qu'un titre > 1:800 est fortement corrélé à la présence d'une endocardite. Le diagnostic sérologique présente toutefois certaines limites. Il existe d'une part une variabilité des taux d'anticorps détectés en fonction de la technique de préparation des antigènes bactériens: les antigènes préparés à partir de bactéries cultivées sur cellules eucaryotes donnent généralement des titres supérieurs que ceux préparés à partir de cultures sur gélose. D'autre part, de nombreux patients infectés par Bartonella sp. ne présentent pas d'anticorps spécifiques à un taux détectable. C'est le cas notamment de la plupart des patients immunodéprimés, ce qui limite l'intérêt de la sérologie au cours de l'angiomatose bacillaire ou de la péliose hépatique. La sérologie pose également un problème de spécificité. En effet, il existe des réactions croisées entre les différentes espèces du genre Bartonella, mais surtout entre le genre Bartonella et le genre Chlamydia de même que Coxiella burnetii.

Photo 5 Immunofluorescence indirecte positive pour B. henselae chez un patient atteint de maladie des griffes du chat

Références

  1. Maurin, M., F. Eb, J. Etienne, and D. Raoult. 1997. Serological cross-reactions between Bartonella and Chlamydia species: Implications for diagnosis. J.Clin.Microbiol. 35:2283-2287.
  2. Maurin, M., J. M. Rolain, and D. Raoult. 2002. Comparison of in-house and commercial slides for detection of immunoglobulins G and M by immunofluorescence against Bartonella henselae and Bartonella quintana. Clin.Diag.Lab.Immunol. 9:1004-1009.
  3. Rolain, J. M., C. Lecam, and D. Raoult. 2003. Simplified serological diagnosis of endocarditis due to Coxiella burnetii and Bartonella. Clin.Diag.Lab.Immunol. 10:1147-1148.

10. Western blot

Le western blot avec adsorption croisée permet de poser le diagnostic d'endocardite et d'identifier l'espèce en cause. Principe : pour les endocardites à Bartonella, on utilise en général deux antigènes, parfois plus si nécessaire. Les antigènes correspondent à l'étiologie suspectée et l'autre antigène le plus vraisemblable. Son choix est basé sur le niveau de réaction en immunofluorescence (on prend celui qui a le titre le plus élevé) et sur la vraisemblance épidémiologique. L'absorption croisée consiste à tester 3 échantillons du sérum à une dilution donnée (en général 1/200e) avant manipulation, puis après avoir fait réagir le sérum avec l'antigène A, ou

Photo 6 Exemple : Endocardite à B. henselae (après absorption avec l'antigène B. henselae, tous les anticorps ont été enlevés ; photo de droite)

l'antigène B. Il faut les tester ensuite en Western Blot contre les antigènes A et B. Le sérum non absorbé montre des anticorps contre A et B. Le sérum absorbé ne doit plus présenter de réaction contre l'antigène avec lequel il a été absorbé. En revanche, si l'un des antigènes enlève à la fois les anticorps contre les antigènes homologues et hétérologues (par exemple après absorption par A, il ne reste d'anticorps ni contre A ni contre B, alors que l'absorption par B laissant des anticorps contre A) on peut affirmer avec certitude qu'il existe une réaction spécifique qui est provoquée par A.

Référence

  1. Houpikian, P. and D. Raoult. 2003. Western immunoblotting for Bartonella endocarditis. Clin.Diagn.Lab Immunol. 10:95-102

11. Examen anatomopathologique

Au cours de la maladie des griffes du chat l'examen histologique du ganglion montre un granulome gigantocellulaire non spécifique, partiellement nécrotique au sein duquel B. henselae peut être mis en évidence par la coloration de Warthin-Starry. L'examen anatomo pathologique permet également d'écarter une néoplasie (carcinome épidermoïde, lymphome..).

Les lésions d'angiomatose bacillaire cutanée se caractérisent par une prolifération capillaire lobulaire, et des cellules endothéliales constituant la paroi des néovaisseaux. Ces cellules endothéliales peuvent saillir dans la lumière vasculaire et l'obstruer. Des amas bactériens peuvent être révélés au sein du stroma, par la coloration à l'hématoxyline-éosine sous forme d'amas éosinophiles, par imprégnation argentique (coloration de Warthin Starry), ou de façon plus spécifique par immunofluorescence directe ou immunohistochimie. L'aspect histologique est semblable à celui observé dans les lésions de la verruga peruana (84), et se différentie aisément des lésions de la maladie de Kaposi.

La péliose hépatique se caractérise par une prolifération intense des capillaires sinusoïdes, responsable de la formation de larges espaces vasculaires, associée à un stroma myxoïde contenant quelques cellules inflammatoires. Comme pour l'angiomatose bacillaire, des bactéries peuvent être visualisées dans le stroma par les techniques précédemment citées. Enfin, l'examen anatomo-pathologique des valves cardiaques réséquées au cours des endocardites à Bartonella montre des végétations massives avec une destruction extensive du tissu valvulaire sous-jacent. De nombreuses bactéries peuvent être mises en évidence dans ce tissu valvulaire par imprégnation argentique (coloration de Warthin-Starry) ou par immunohistochimie.

Références

  1. Lepidi, H., P. E. Fournier, and D. Raoult. 2000. Quantitative analysis of valvular lesions during Bartonella endocarditis. Am J Clin Pathol 114:880-889.
  2. Min, K. W., J. A. Reed, and D. F. Welch. 1994. Morphologically variable bacilli of cat scratch disease are identified by immunocytochemical labelling with antibodies to Rochalimaea henselae. Am.J.Clin.Pathol. 101:607-610.
  3. Reed, J. A., D. J. Brigati, S. D. Flynn, N. S. Mcnutt, K. W. Min, D. F. Welch, and L. N. Slater. 1992. Immunocytochemical identification Rochalimaea henselae in bacillary (epithelioid) angiomatis, parenchymal bacillary peliosis, and persistent fever with bacteriema. Am.J.Surg.Pathol. 16:650-657

Photo 7 Lésion cutanée au cours de l'angiomatose bacillaire

Photo 8 Endocardite à Bartonella Coloration de Warthin-Starry

Photo 9 Immunohistochimie

12. Culture

Les bactéries du genre Bartonella peuvent être isolées du sang et des tissus (ganglions lymphatiques, os, foie, peau, moelle osseuse, valve) soit en milieu axénique soit en culture cellulaire. La culture en milieu axénique s'obtient en utilisant des milieux enrichis avec du sang frais, en atmosphère humide, en présence de 5% de CO2. La température optimale de croissance est 37°C. Les cultures cellulaires utilisent des cellules L929, HeLa, ou des cellules endothéliales. Une combinaison des deux techniques semble nécessaire pour obtenir un résultat optimal. Toutefois, la culture des bactéries du genre Bartonella demeure fastidieuse, en particulier à partir des ganglions, et n'a permis d'établir un diagnostic spécifique que dans un faible nombre de cas seulement ce qui témoigne de la difficulté d'isolement de cette bactérie. L'examen bactériologique standard permet d'écarter la possibilité d'une éventuelle adénite bactérienne autre comme Brucella, Mycobacterium, Yersinia, Chlamydia trachomatis.

Photo 10 Culture de B. henselae sur gélose au sang

Photo 11 coloration de Gimenez de B. henselae

Référence

  1. La Scola, B. and D. Raoult. 1999. Culture of Bartonella quintana and Bartonella henselae from human samples: a 5-year experience (1993 to 1998). J.Clin.Microbiol. 37:1899-1905

13. Amplification directe par PCR

L'amplification directe par PCR à partir de différents prélèvements biopsiques est la technique la plus spécifique pour effectuer le diagnostic d'infection à Bartonella en particulier pour le diagnostic de la maladie des griffes du chat à partir du ganglion.

Ce sont des techniques invasives, nécessitant la pratique de biopsies tissulaires. Différents gènes on été utilisés (voir annexe listing des gènes utilisables et références), et actuellement au centre national de référence nous réalisons une amplification génique de trois gènes spécifiques, le gène pap31, le gène groEl et le gène ITS, par une technique de PCR quantitative en temps réel à l'aide de sondes d'hydrolyse.

Quel que soit le gène amplifié, la spécificité des fragments amplifiés doit être vérifiée, soit par séquençage (Figure), soit par hybridation avec une sonde spécifique.

Photo 12 Exemple :Séquençage du produit de PCR du gène ITS

Références

  1. Roux, V. and D. Raoult. 1995. Inter-and intraspecies identification of Bartonella (Rochalimea) species. J.Clin.Microbiol. 33:1573-1579.
  2. Zeaiter, Z., P. E. Fournier, G. Greub, and D. Raoult. 2003. Diagnosis of Bartonella endocarditis by a real-time nested PCR assay using serum. J.Clin.Microbiol. 41:919-925.
  3. Zeaiter, Z., P. E. Fournier, H. Ogata, and D. Raoult. 2002. Phylogenetic classification of Bartonella species by comparing groEL sequences. Int.J.Syst.Evol.Microbiol. 52:165-171.
  4. Zeaiter, Z., P. E. Fournier, and D. Raoult. 2002. Genomic variation of Bartonella henselae strains detected in lymph nodes of patients with cat scratch disease. J.Clin.Microbiol. 40:1023-1030.
  5. Fenollar, F. and D. Raoult. 2004. Molecular genetic methods for the diagnosis of fastidious microorganisms. APMIS 112:785-807

Il est également possible également de détecter directement B. henselae par immunofluorescence sur des frottis de ganglions à l'aide d'un anticorps monoclonal (Photo)

Photo 13 Immunodétection de B. henselae sur frottis ganglionnaire d'un patient atteint de maladie des griffes du chat.

Enfin il est possible de détecter directement Bartonella dans les globules rouges humains ou chez le chat

Références

  1. Rolain, J. M., C. Foucault, R. Guieu, B. La Scola, P. Brouqui, and D. Raoult. 2002. Bartonella quintana in human erythrocytes. Lancet 360:226-228.
  2. Rolain, J. M., P. E. Fournier, D. Raoult, and J. Y. Bonerandi. 2003. First Isolation and Detection by Immunofluorescence Assay of Bartonella koehlerae in Erythrocytes from a French Cat. J.Clin.Microbiol. 41:4001-4002.
  3. Rolain, J. M., F. Gouriet, M. Enea, M. Aboud, and D. Raoult. 2003. Detection by immunofluorescence assay of Bartonella henselae in lymph nodes from patients with cat scratch disease. Clin.Diag.Lab.Immunol. 10:686-691.
  4. Rolain, J. M., B. La Scola, Z. Liang, B. Davoust, and D. Raoult. 2001. Immunofluorescent Detection of Intraerythrocytic Bartonella henselae in Naturally Infected Cats. J.Clin.Microbiol. 39:2978-2980.
  5. Rolain, J. M., C. Locatelli, L. Chabanne, B. Davoust, and D. Raoult. 2004. Prevalence of Bartonella clarridgeiae and Bartonella henselae in domestic cats from France and detection of the organisms in erythrocytes by immunofluorescence. Clin.Diagn.Lab Immunol. 11:423-425.

Tableau 1 Intérêt des examens biologiques en fonction des manifestations cliniques


Histologie Sérologie Culture PCR
Maladie des Griffes du chat + ++ + +++
formes viscérales ++ ++ ++ +++
méningo-encéphalite - + + +++
rétinite - + + +++
Endocardite ++ +++ ++ +++
Angiomatose bacillaire +++ - + ++
Péliose hépatique +++ - + ++
Bactériémies isolées - + ++ ++





14. Traitement - Prévention

Classiquement la maladie des griffes du chat est insensible au traitement antibiotique. La gestion médicale des patients consiste en l'administration d'analgésiques pour la douleur et un suivi de l'évolution clinique des patients. Un traitement par l'azithromycine (500mg le 1er jour puis 250 mg/jour pendant 4 jours) peut être proposé chez les patients présentant une volumineuse adénopathie. Si l'adénopathie suppure, une aspiration à l'aiguille représente le meilleur traitement et les patients notent une diminution de la douleur en 24 à 48 heures. Dans les formes compliquées de maladie des griffes du chat, une association doxycycline (200 mg/jour) associée à la rifampicine (600 mg/jour) a été utilisée avec succès dans des cas de rétinites. Le traitement de l'angiomatose bacillaire repose sur l'utilisation d'érythromycine (2 g/j) pendant 3 mois ou la doxycycline (200 mg/j) pendant 3 mois. Enfin, les endocardites doivent être traitées par une association de gentamicine (3 mg/kg/j) pendant 14 jours et doxycycline (200 mg/j) pendant 6 semaines.

Pour prévenir cette maladie, il est proposé de traiter les chats infectés et de contrôler l'infestation des chats par les puces. Il n'existe pas de vaccin contre la maladie des griffes du chat

Références

  1. Rolain, J. M., Brouqui, P., Koehler, J. E., Maguina, C., Dolan, M. J. & Raoult, D. (2004) Antimicrob. Agents Chemother. 48, 1921-1933.
  2. Bass, J. W., Freitas, B. C., Freitas, A. D., Sisler, C. L., Chan, D. S., Vincent, J. M., Person, D. A., Claybaugh, J. R., Wittler, R. R., Weisse, M. E. et al. (1998) Pediat. Inf. Dis. J. 17, 447-452.
  3. Margileth, A. M. (2000) Curr. Infect. Dis. Rep. 2, 141-146.
  4. Koehler, J. E. & Relman, D. A. (2002) in Antimicrobial therapy and vaccines, eds. Yu, V. L., Weber, R., & Raoult, D. (Apple Trees Production, LLC, New York), pp. 925-931.



Tableau 2 Recommandations thérapeutiques pour le traitement des infections à Bartonella henselae (d'après Rolain JM et al Antimicrob Agents Chemother, 2004, 48 :1921-1933


Maladie Adultes Enfants
Maladie des Pas de traitement antibiotique ou Azithromycine 500 mg Pas de traitement antibiotique ou Azithromycine 500 mg le 1er jour puis
griffes du chat le 1er jour puis 250 mg pendant 4 jours si forme compliquée ou suppurée 250 mg pendant 4 jours si forme compliquée ou suppurée
Angiomatose bacillaire Erythromycine 2 g/j pendant 3 mois Erythromycine 2 g/j pendant 3 mois
Péliose hépatique Erythromycine 2 g/j pendant 4 mois Erythromycine 2 g/j pendant 4 mois
Endocardite Gentamicine 3 mg/kg/j pendant 3 semaines et amoxicilline 12 g/j inconnu
pendant 6 semaines ou doxycycline 200 mg/j pendant 6 semaines




15. Liste des références des gènes utilisables pour amplifier les bactéries du genre Bartonella

Tableau 3 Liste des séquences utilisables pour amplifier les bactéries du genre Bartonella


Microrganisme Gène primer Séquence Ref
B. clarridgeiae ribC F PBC5 TACATAACGAGCCAATT 2
B. clarridgeiae ribC R PBC15 TAGCTTTAGAACAATATGGT 2
B. henselae ribC F PBH-L1 GATATCGGTTGTGTTGAAGA 2
B. henselae ribC R PBH-R1 AATAAAAGGTATAAAACGCT 2
B. bacilliformis ribC F PBH-L1 GATATCGGTTGTGTTGAAGA 2
B. bacilliformis ribC R PBB-R1 AAAGGCGCTAACTGTTC 2
B. quintana ribC F PBH-L1 GATATCGGTTGTGTTGAAGA 2
B. quintana ribC R PBQ-R1 AAAGGGCGTGAATTTTG 2
All Bartonella ribC F PBH3 CCAAGTGCTACATAACCATC 2
All Bartonella ribC R PBH4 CGGGTTGTTATTGCTCTTAC 2
All (except B. bacilliformis) 16s-23s spacer F 16SF AGAGGCAGGCAACCACGGTA 3
All (except B. bacilliformis) 16s-23s spacer R 23S1 GCCAAGGCATCCACC 3
All Bartonella 16s-23s spacer F QHVE1 TTCAGATGATGATCCCAA 3
All Bartonella 16s-23s spacer R QHVE2 TTGGGATCATCATCTGAA 3
All Bartonella 16s-23s spacer F QHVE3 GATATATTCAGACATGTT 3
All Bartonella 16s-23s spacer R QHVE4 AACATGTCTGAATATATC 3
B. bacilliformis 16s-23s spacer F BABF CTGGATCACCTCCTTTCTAA 3
B. bacilliformis 16s-23s spacer R BABR ATGCCCTTAAGACACTTGAT 3
B. quintana 16s-23s spacer F BQF CTCCACCATTTTAGGTCATC 3
B. quintana 16s-23s spacer R BQR GGTTTTGAGAATTCCCTTGC 3
All Bartonella 16s-23s spacer F 16s1 (C/T)CTTCGTTTCTCTTTCTTCA 4
All Bartonella 16s-23s spacer R 16s2 GGATAAACCGGAAAACCTTC 4
All Bartonella 16s-23s spacer F 16s3 (C/T)CTTCGTTTCTCTTTCTTCA 4
All Bartonella 16s-23s spacer R 16s4 AACCAACTGAGCTACAAGCC 4
All Bartonella 16s-23s spacer F 16s5 CTCTTTCTTCAGATGATGATCC 4
All Bartonella 16s-23s spacer R 16s6 AACCAACTGAGCTACAAGCCCT 4
All Bartonella ribC F BARTON-1F TAACCGATATTGGTTGTGTTGAAG 6
All Bartonella ribC R BARTON-2R TAAAGCTAGAAAGTCTGGCAACATAACG 6
All Bartonella 16s S probe ATTTGGTTGGGCACTCTAGGGG 7
All Bartonella 16s Rp2a ACGGCTACCTTGTTAGGACTT 8
All Bartonella 16s F 357f TACGGGAGGCAGCAG 8
All Bartonella 16s R 357ra CTGCTGCCTCCCGTA 8
All Bartonella 16s F 536F CAGCAGCCGCGGTAATAC 8
All Bartonella 16s R 536R GTATTACCGCGGCTGCTG 8
All Bartonella 16s F 800F ATTAGATACCCTGGTAG 8
All Bartonella 16s R 800R CTACCAGGGTATCTAAT 8
All Bartonella 16s F 1050F TGTCGTCAGCTCGTG 8
All Bartonella 16s R 1050R CACGAGCTGACGACA 8
All Bartonella 35KD F 35KD1fa GTCGCTAAAGGCTGATGA 8
All Bartonella 35KD R 35KD2ra GACTGATATCGTGCGTGTG 8
All Bartonella 35KD F 35KDs1f GGTACGACGACAGTAATTGTT 8
All Bartonella 35KD R 35KDs2r GATTTAAGAGATACCAACCA 8
All Bartonella PAP F PAP1fa CTTTAATGACGACTTCTGTT 8
All Bartonella PAP R PAP4ra CCGAAATCTGAGTAACGGTA 8
All Bartonella PAP R PAP2r CCCTAAATGTTTCAAGTTCA 8
All Bartonella PAP F PAP3f GCTGACAGAGAAGACGCAA 8
All Bartonella groEL F BbHs233.p CGTGAAGTTGCCTCAAAAACC 9
All Bartonella groEL R BbHs1630.n AATCCATTCCGCCCATTC 9
All Bartonella rpoB F QVE1 TTCAGATGATGATCCCAAGC 10
All Bartonella rpoB R QVE3 AACATGTCTGAATATATCTTC 10
All Bartonella Bfp1 ATTAATCTGCAYCGGCCAGA 14
All Bartonella Bfp2 ACVGADACACGAATAACACC 14
All Bartonella Bfs3 TTACAAAAATCYGTTGATAC 14
All Bartonella Bfs4 GTATCAACRGATTTTTGTAA 14
All Bartonella ftsZ F BaftsZF GCTAATCGTATTCGCGAAGAA 14
All Bartonella ftsZ R BaftsZR GCTGGTATTTCCAAYTGATCT 14
B. henselae, B. clarridgeiae ftsZ BhftsZ 1393.n GCGAACTACGGCTTACTTGC 14
B. henselae, B. clarridgeiae ftsZ Bh ftsZ 1247.p CGGTTGGAGAGCAGTTTCGTC 14
B. quintana ftsZ F Bq ftsZseqF GCACATATTCTTGATGAGAT 14
B. quintana ftsZ R Bq ftsZseqR CCCCTATCATCTCATCAAG 14
B. bacilliformis ftsZ F Bb ftsZseqF GCGCATGTTCTTAGTGAAAT 14
B. bacilliformis ftsZ R Bb ftsZseqR CCTGTATACGTGATGCATTT 14
All Bartonella ftsZ FTS1p GCCTTCTCATCCTCAACTT 14
All //Bartonella/ ftsZ FTS2p CAGCCTCTTCACGATGTG 14
All Bartonella pap31 PAPn1 TTCTAGGAGTTGAAACCGAT 15
All Bartonella pap31 PAPn2 GAAACACCACCAGCAACATA 15
All Bartonella pap31 PAPns2 GCACCAGACCATTTTTCCTT 15
All Bartonella pap31 PAPns1 CAGAGAAGACGCAAAAACCT 15
All Bartonella groEL HSPps1 CAGAAGTTGAAGTGAAAGAAAA 15
All Bartonella groEL HSPps2 GCNGCTTCTTCACCNGCATT 15
All Bartonella groEL HSPps4 GCTGGNGGTGTTGCNGTTA 15
All Bartonella groEL HSPps3 GCTGTNGAAGANGGNATTGT 15

Références

  1. Anderson, B. E. and M. A. Neuman. 1997. Bartonella spp. as emerging human pathogens. Clin.Microbiol.Rev. 10:203-219.
  2. Bereswill, S., S. Hinkelmann, M. Kist, and A. Sander. 1999. Molecular analysis of riboflavin synthesis genes in Bartonella henselae and use of the ribC gene for differentiation of Bartonella species by PCR. J.Clin.Microbiol. 37:3159-3166.
  3. Houpikian, P. and D. Raoult. 2001. 16S/23S rRNA Intergenic Spacer Regions for Phylogenetic Analysis, Identification, and Subtyping of Bartonella Species. J.Clin.Microbiol. 39:2768-2778.
  4. Jensen, W. A., M. Z. Fall, J. Rooney, D. L. Kordick, and E. B. Breitschwerdt. 2000. Rapid identification and differentiation of Bartonella species using a single-step PCR assay. J.Clin.Microbiol. 38:1717-1722.
  5. Joblet, C., V. Roux, M. Drancourt, J. Gouvernet, and D. Raoult. 1995. Identification of Bartonella (Rochalimaea) species among fastidious Gram-negative bacteria based on the partial sequence of the citrate-synthase gene. J.Clin.Microbiol. 33:1879-1883.
  6. Johnson, G., M. Ayers, S. C. McClure, S. E. Richardson, and R. Tellier. 2003. Detection and identification of Bartonella species pathogenic for humans by PCR amplification targeting the riboflavin synthase gene (ribC). J.Clin.Microbiol. 41:1069-1072.
  7. Kerkhoff, F. T., A. M. C. Bergmans, A. van der Zee, and A. Rothova. 1999. Demonstration of Bartonella grahamii DNA in ocular fluids of a patient with neuroretinitis. J.Clin.Microbiol. 37:4034-4038.
  8. La Scola, B., Z. Liang, Z. Zeaiter, P. Houpikian, P. A. D. Grimont, and D. Raoult. 2002. Genotypic characteristics of two serotypes of Bartonella henselae. Journal of Clinical Microbiology 40 :2002-2008.
  9. Marston, E. L., J. W. Sumner, and R. L. Regnery. 1999. Evaluation of intraspecies genetic variation within the 60 kDa heat-shock protein gene (groEL) of Bartonella species. Int J Syst Bacteriol 49:1015-1023.
  10. Patel, R., J. O. Newell, G. W. Procop, and D. H. Persing. 1999. Use of polymerase chain reaction for citrate synthase gene to diagnose Bartonella quintana endocarditis. Am J Clin Pathol 112:36-40.
  11. Renesto, P., J. Gouvernet, M. Drancourt, V. Roux, and D. Raoult. 2001. Use of rpoB gene analysis for detection and identification of Bartonella species. J.Clin.Microbiol. 39:430-437.
  12. Roux, V. and D. Raoult. 1995. The 16S-23S rRNA intergenic spacer region of Bartonella (Rochalimaea) species is longer than usually described in other bacteria. Gene 156:107-111.
  13. Zeaiter, Z., P. E. Fournier, H. Ogata, and D. Raoult. 2002. Phylogenetic classification of Bartonella species by comparing groEL sequences. Int.J.Syst.Evol.Microbiol. 52:165-171.
  14. Zeaiter, Z., P. E. Fournier, and D. Raoult. 2002. Genomic variation of Bartonella henselae strains detected in lymph nodes of patients with cat scratch disease. J.Clin.Microbiol. 40:1023-1030.
  15. Zeaiter, Z., Z. Liang, and D. Raoult. 2002. Genetic classification and differentiation of Bartonella species based on comparison of partial ftsZ gene sequences. J.Clin.Microbiol. 40:3641-3647.

16. Informations pratiques

16.1. Consultations au sein de la fédération de Microbiologie - Marseille

Le Pr Didier RAOULT (ou un de ses collaborateurs) assure une consultation hebdomadaire tous les mercredi matin à l'hôpital de la Timone, Marseille et peut vous recevoir après rendez-vous auprès de son secrétariat (contact : didier.raoult@medecine.univ-mrs.fr ; tel : 04 91 38 55 17)

16.2. Quels prélèvements envoyer et comment les envoyer ?

Maladie des griffes du chat / Angiomatose bacillaire

Endocardite

Prélèvements anciens et blocs de paraffine peuvent être utiles au diagnostic (Anatomopathologie - Immunohistochimie - PCR)

Correspondant au sein de l'IFR48

16.3. Fiche de recueil épidémiologique - Infections à Bartonella

Conformément à la loi de Bioéthique de 2004 les patients doivent être informés que les résultats des investigations pourront être utilisés à des fins de recherche et être publiés après avoir été rendus anonymes.